Q: Which region are untranslation region?
A: Translation: It is a process that converts the sequence of mRNA into amino acids during protein…
Q: what are the start and stop codons?
A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: What is Histone Modification?
A: Histones are proteins that forms the primary structure of chromosomes. DNA binds around the histone…
Q: What is a histone variant?
A: Proteins are large biomolecules consisting of one or more long chains of amino acids residues.…
Q: What Are the Rules in Codon–AnticodonPairing?
A: The tRNA carries out the amino acids to the mRNA in a specific order which was determined by the…
Q: What are the functions of start and stop codons? Giveexamples.
A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: What is the transcribed sequence
A: Sequence that is transcribed from the template DNA using complementary base pairing rules are known…
Q: Does a sequence contain a gene?
A: DNA stands for doexyribonucleic acid which is made up of phosphate group, sugar group and…
Q: what amino acid is coded for by the codon 5AAG3?
A: Proteins are constructed from amino acids. Each amino acid is made up of a carboxyl group and an…
Q: What would be the effect of an insertion or deletion of one of the bases in a codon?
A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…
Q: What is a retromer?
A: Cell surface receptor are the receptor that are embedded in the plasma membrane of cells. They act…
Q: What are repetitive sequences ?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: How many bases are in one codon? *
A: A codon is a sequence of three RNA nucleotides on the messenger RNA (mRNA) that corresponds with a…
Q: What do you mean by cross-exon recognition complex ?
A: CROSS - EXON RECOGNITION COMPLEX : The sequence of DNA present in mature messenger RNA some of which…
Q: Define: codon, anticodon, and nonsense codon.
A: The translation is involved in the production of polypeptide chain from the mRNA. The translation…
Q: What are the function of exons?
A: Eukaryotic genes are mainly composed of two components - introns and exons. Introns are the…
Q: What does the lacA gene code for?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What is RNA transcript?
A: Ribonucleic acid is the macromolecule that is composed of ribose sugar, a phosphoric acid group, and…
Q: Which CodonsRepresent Which Amino Acids?
A: Protein plays an important role in structural and functional unit in the body. Proteins are made up…
Q: What is a codon? What does it represent?
A: The genetic framework is a set of instructions that living cells use to decode the information…
Q: What are helicases and topoisomerases?
A: Enzymes are the proteins present in the cells and have catalytic powers.
Q: Why could a codon not consist of only two bases?
A: The genetic information of DNA is based on the nucleotide base sequences. These sequences are…
Q: How did the genetic code originate?
A: Genetic code includes three letters of nucleotides that code for a particular amino acid.
Q: What is codon bias?
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: Which of the DNA strands is used in transcription?
A: Step 1 Transcription is the formation of RNA (ribonucleic acid) over the template DNA. It generates…
Q: What is the genetic code?
A: Deoxyribonucleic acid is a molecule composed of polynucleotide chains. It coils around each other to…
Q: How does the presence of introns aid exon shuffling?
A: Exon shuffling is a mechanism, where two or more exons from different genes brought together, or…
Q: How many introns are present on a gene that consists of 2 exons?
A: Introns and exons are nucleotide sequences in a gene. Introns can be considered as intervening…
Q: What causes exon shuffling?
A: Exon shuffling is a molecular mechanism for the formation of new genes. It is a process through…
Q: What is a mutagen?
A: The human genome is very dynamic in nature, it tends to mutate and any change in the genetic…
Q: How many exons has the CFTR gene?
A: Introduction :- The CFTR gene encodes a membrane protein and chloride channel in vertebrates called…
Q: What is the sequence of bases for the start codon and what amino acid is made?
A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…
Q: What do you understand by the degeneracy of codon? Give example
A: The DNA contains the information needed for the functioning of all living things in the form of…
Q: What could be the effect of a deletion, substitution or addition that alters the sequence of the…
A: Stop codon is a nucleotide triplet which is present in mRNA. This is also known as termination…
Q: What is long noncoding RNA?
A: Long non-coding RNAs are a type of RNA, defined as being transcripts with lengths exceeding 200…
Q: What are histone tails?
A: Chromosomes appear at the time of cell division in the form of thread like structures inside the…
Q: A standard codon table such as the one that we looked at in class gives the following information:
A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…
Q: where are codons found in RNA
A: The whole process is known as Central Dogma which involves two processes:- 1) When DNA changes into…
Q: What are the four major types of introns?
A: Introns are the non-coding sequence found in the genome. These are nucleotide sequences that do not…
Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…
A: Codon is sequences of three DNA or RNA nucleotides.
Q: What is RNA interference?
A: Recombinant DNA technology (rDNA technology) is extremely useful for analyzing a species' entire…
Q: What are the difference between exons and introns?
A: A single-stranded molecule of RNA that is complementary to one of the strands of DNA of a gene is…
Q: Name the three non-sense codons?
A: The genetic material is known to carry the information that is translated and read as triplet code,…
Q: Name the two initiating codons?
A: From the central dogma concept, we knew there is an intricate connection between genes and synthesis…
Q: What is exon shuffling?
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Which base pairings account for wobble at the third codon–anticodon position?
A: Wobble hypothesis is the base pairing of two nucleotides in an RNA molecule that does not follow the…
Step by step
Solved in 2 steps
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?What is the tagged specific structure?
- using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic perspective, why is this advantageous?3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).
- How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? ExplainWhat is a motif? Why is it useful for computer programs to identifyfunctional motifs within amino acid sequences?Examine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGG