Which of the following are characteristics of “small” monomeric Ras GTPases? A. Membrane bound B. Act as molecular switches between GTP & GDP C. They interact with receptors directly to regulate upstream events D. They are activated upon GTP binding E. None of the above

Which of the following are characteristics of “small” monomeric Ras GTPases? A. Membrane bound B. Act as molecular switches between GTP & GDP C. They interact with receptors directly to regulate upstream events D. They are activated upon GTP binding E. None of the above

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter9: Cell Communication

Section: Chapter Questions

Problem 2VCQ: Figure 9.10 In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means...

See similar textbooks

Related questions

Q: You are part of the radiology team at an ER. A 6 year old child comes in, who may have a broken bon...

A: Interpretation of the broken bone X-ray

Q: How does the transcribed mRNA convert into a functional protein?

A: Introduction: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulu...

Q: How biodiversity reflected the environment?

A: Introduction: Biodiversity means the diversity of life forms. It is a word commonly used to refer to...

Q: Both overweight and underweight people share an increased risk of developing: (stated differently: t...

A: Sleep apnea:- The most common cause of sleep apnea is excess weight and obesity, this condition is o...

Q: A can cleave the hinge of each heavy chain as shown below.

A: IgG is cleaved with a protease that is the one which targets the hinge region. Proteolytic cleavage...

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: Answer the following provided in the table. You may answer it briefly or by using a bullet. Charac...

A: Characteristics unique to seaweeds They have holdfast which help in attachment to hard surfaces th...

Q: Determine which of the following passages are arguments. For those that are, identify the conclusio...

A: Note- As we are allowed to answer only one question at a time. I will provide answer for only first ...

Q: What are the techniques in solving pedigree problems?

A: Techniques of solving pedigree problems:- A step wise guide to mastering pedigree questions: - Firs...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: DNA is stands for Deoxyribonucleic acid.It is a genetical material present in all peoples.Every pers...

Q: Roy was a ruthless, manipulative, self-centered person who stole from anyone and felt no remorse. Ev...

A: Narcissistic:- It is a mental condition in which people have an inflated sense of their own importa...

Q: Briefly answer the question below: What is the disadvantage of having a really thick smear when stai...

A: Smear:- It is used to fix the bacteria onto the slide and to prevent the sample from being lost duri...

Q: peroxisome nuclear pore chloroplast nucleus smooth ER nucleolus microfilament ribosome Golgi apparat...

A: INTRODUCTION Cell is a basic functional unit of life system. Cell is mainly a collectio...

Q: Glucose molecules are fully reabsorbed in the proximal tubule that normally, zero amount of glucose ...

A: Glucose is a form of sugar that is the main source of energy in our body.Normally, glucose is not or...

Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...

A: Introduction: Hyperkalemia is a condition of high potassium levels in blood.

Q: The table below summarises the three stages of Meselson and Stahl's experiment and their results. (a...

A: While proposing the double helical structure of DNA Watson and crick had immediately proposed for r...

Q: Which structure is highlighted? Multiple Choice saphenous nerve obturator nerve sciatic nerve and br...

A: Introduction Saphenous nerve:- it is the largest branch of the femoral nerve and innervates the medi...

Q: 1. Let's imagine what would happen to the amount of DNA material in a cell if, when it reproduced, i...

A: * During mitosis there are the following phases G1 phase S phase G2 phase M phase * During G1 pha...

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are con...

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and beco...

Q: intermediate filaments 1. In eukaryotic flagella, the fibers that slide past one another due to the ...

A: Intermediate filaments: They anchors the nucleus and maintains its rigidity Microtubules: They aids ...

Q: similarities and differences between malaria and covid 19

A: An infection is the invasion of an organism's body tissues by disease-causing agents, their multipli...

Q: female nurses in their forties who don't drink with

A: Vaccine: It is substance which triggers the bodies immune system against a particular disease.

Q: Where is the sucrose produced by photosynthesis generated?

A: Photosynthesis includes light-dependent and light-independent phases.

Q: Which reaction normally happens in the regulation of the trp operon when high levels of tryptophan a...

A: The trp repressor controls the trp operon. When coupled to tryptophan, the trp repressor prevents th...

Q: It is the process where the parent's gene pairs separate.

A: Separation of different traits of the same gene or allele pair during meiosis so that they can trans...

Q: Photosynthesis in green and purple bacteria does not produce O2. Why? How can these organisms still ...

A: Photosynthesis is the process that occurs in the presence of sunlight.

Q: 2- Supposed that you have a DNA sequence sample with 10,000 bp. By using 2 different restriction enz...

A: The answer is 3.

Q: Acetic acid (a weak acid with a pKa of 4.75) and ethanol (an alcohol) are each composed of two carbo...

A: The plasma membrane is primarily composed of lipids. These are made up of fatty acids and glycerol. ...

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with ...

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple...

Q: Compare the advantages of Linnaean and phylogenetic classification systems

A: Introduction: Classification is a very important aspect of Biology. It has greatly eased the study o...

Q: Movement of glucose from one side to the other side of the intestinal epithelium is a major example ...

A: Digestion of carbohydrates produces monosaccharides.

Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short leng...

A: The transcription is the process by which RNA is produced from the DNA template and the translation ...

Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...

A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...

Q: If your results plate was the image labeled RESULTS, as compared to the image labeled as the EXAMPLE...

A: ANSWER;- 1. While image 1 shows the pure form of colonies of E.coli because it appears the same in c...

Q: QUESTION 17 Neurotranamtes Can induce Ca** flux in a muscie cell and thus muscle contraction are eff...

A: Answer 17) C- neurotransmitters are released at the synapse

Q: Most healthy body cells spend the majority of their lives in_____ . a. prophase d. telophase b. meta...

A: Introduction All living organisms are made up of cells, which are the basic building components. The...

Q: Figure It Out #5...Name that Complex Carb Fiber Sucrose Starch and Fiber Human Brain Human Liver Coo...

A: Galactose: Human Brain Fiber and Starch: Whole wheat bread Fiber and Sucrose: Starburst, Strawberry ...

Q: An important function of the inner mitochondrial membrane is to provide a selectively permeable barr...

A: Introduction Mitochondria are eukaryote cell organelles or components. They're not in the nucleus; t...

Q: Which of the formed elements arise from myeloid stemcells?a. B cellsb. natural killer cellsc. platel...

A: Myeloid stem cells are commonly known as myeloid progenitor cells. These cells are derived from hema...

Q: 5. Suppose that you made a mistake when you set up the thermocycler program and omitted the first 2 ...

A: Answer: 5 : the first 2 minutes at 95 degree Celsius is needed to open the dna if this is omitted th...

Q: When two long-winged flies were mated, the offspring included 77 with long wings and 24 with short w...

A: Introduction :- A recessive gene is one whose effects are concealed when a dominant gene is present....

Q: True or false: Since ATP is generated in chloroplasts, cells capable of undergoing photosynthesis do...

A: ATP stands for Adenosine triphosphates.ATP is a Source of energy for plants and humans to do various...

Q: A group of closely related strains, not all identical * a. class b. specie c. no...

A: A strain is a genetically different variety, a subtype within a biological species. Nomenclature is ...

Q: What additive ingredients are thickeners? Total Fat Sat. Fat Cholesterol Sodium Total Carbohydrate D...

A: Out of the option given all are used as thickeners except caramel colour. Caramel colour is a sugar ...

Q: MAJOR differences in the inflammatory processes which have occurred in your uncle's lungs (he worked...

A: Asbestos: it is along with term disease in the lungs where a scar-like structure is formed on the lu...

Q: How does the translated mRNA convert into a functional protein?

A: Translation is a process in which cells make the proteins.

Q: Do you think the scar would look better (i.e. the wound heal "better") if friend #2 underwent hyperb...

A: This is because the scars of Tb never heals, it cannot be reversed under any circumstances, even whe...

Q: Hardosaurs like edmontosaur or others what ways they can defended against predators like tyrannosaur...

A: Dinosaurs have helped scientists comprehend the Earth and its history by allowing them to examine di...

Q: the photos below show flowers from two Arabidopsisplants. The plant on the left is wild-type (unmuta...

A: Arabidopsis thaliana is used in Alexander bruan experiment to explain the double flower mutant conce...

Q: There are two broad classes of transposons. Each class is characterized by its method of "jumping" (...

Concept explainers

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.

Question

Which of the following are characteristics of “small” monomeric Ras GTPases?

	A.	Membrane bound
	B.	Act as molecular switches between GTP & GDP
	C.	They interact with receptors directly to regulate upstream events
	D.	They are activated upon GTP binding
	E.	None of the above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following mutations would produce a form of the Ras protein that would be more difficult to inactivate than normal Ras? Briefly explain your reasoning.(i) A mutation that allows Ras to cleave (hydrolyze) GTP more rapidly than usual(ii) A mutation that causes Ras to bind Ras-GAP more tightly than usual(iii) A mutation that causes Ras to cleave (hydrolyze) GTP more slowly than usual
Briefly describe the following properties of the Ras GTPases: a) Size, structure and cellular localization (for structure I want to know if they are lipidated and any other unique features) , b) How are they activated and inactivated (i.e. include the GEFs and GAPs), c). Give an example of downstream effector proteins, d). Are they or could they be involved in human cancer.
Even in the presence of a Ras-GAP, a single amino acid change in as renders it incapable of hydrolyzing GTP. This mutation is known as Ras+ and is a cancer-causing mutation. What effect do you think this mutation will have on signaling downstream of Ras+? Why? a)A mutation would turn on the signaling pathway all of the time. b)Even if a route is mutated, it can still be turned on or off. c)Due to a mutation, the signaling pathway would always be off.
Which of these BEST describes how the signal is transduced from the EGF receptor to the Ras protein? A. Ras is phosphorylated B. Ras is dephosphorylated C. Ras binds to a GTP molecule D. Ras hydrolyzes a GTP molecule
A mutation in Ras that prevents Ras from hydrolyzing GTP. Would cause? Why? A. Increased proliferation B. Decreased proliferation
what protein is phosphorylated by Raf in the Ras/MAP kinase signal transduction cascade? I put ERK2 and ERK1 but was partially incorrect, what was the part I messed up on that would be correct? I know that one of the two is there but correct me if i'm wrong
Figure 9.10 In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means that the RAS protein can no longer hydrolyze GTP into GDP What effect would this have on downstream cellular events?
What is the function of Ras during tyrosine kinase cell signaling? a. It activates the opening of channel-linked receptors. b. It is an enzyme that synthesizes second messengers. c. It links the receptor protein to the MAP kinase pathway. d. It phosphorylates other enzymes as part of a pathway.
We have studied Ras signal transduction pathway. In an experiment, two different mutations were produced using different chemicals. The proteins with mutation are listed below. State what will be the effect of each mutation and explain whether it will result in cell proliferation or not. GEF protein GTPase
1. a cancer causing virus causes --- in susceptible cultured cells. a. foci b. plaques 2. Lack of associated GTPase activity will result in ---- of Ras protein. a. inactivation b. deletion c. constitutive activation d. no difference in activity
a.What would happen if IKKbeta did not phosphorylate IkappaB? b.Why is it so hard to make cytokine therapies? c.Why would you use the MyD88 independent pathway versus the MyD88 dependent pathway?
Look at the figure and predict what would happen if the SRPRNA was unable to stimulate the GTPase activities of the GTPbindingproteins within SRP and the SRP receptor.