Which of the following are necessary for Sanger sequencing? Select all correct answers. Group of answer choices ddNTPs an oligonucleotide primer DNA polymerase dNTPs DNA ligase a restriction enzyme
Q: True/False: The small subunit of a ribosome catalyzes the formation of the peptide bonds that link…
A: Introduction: An mRNA molecule is attached to by a little ribosomal subunit during translation. A…
Q: Activity: Who's the Real Father? Nathaniel lost his mom Rachel. According to the family lawyer, all…
A: There are mainly four blood groups A, B, Ab and O. These blood groups are named according to the…
Q: Aminoglycosides and ß-lactams are commonly used antibiotics. Write a short account for both…
A: Aminoglycosides are bacterial antibiotics. They treat bacterial infections by killing the bacteria…
Q: What is true of cell signaling? Extracellular signals transduced by receptors always alter cell…
A: The cells receive signals from their external environment, which alters the cell's activity and…
Q: Your fish uses countercurrent exchange of gases in their respiratory organ. Explain the…
A: Most gas exchange during respiration in most of the animals happens by the counter current…
Q: The graph monitors antibody titer over time in a patient. What is happening at time d? Antibody…
A: Introduction An organism's immune system is a network of biological organs and mechanisms that…
Q: How does the intestines Form supports its Function?
A: Introduction :- The small intestine is the longest portion of the gastrointestinal tract, which is…
Q: Once the steps for RNA seq have been identified, write the steps in the order in which they are…
A: The word Transcriptome refers to the amount of total RNA transcripts in an organism. Transcriptome…
Q: Another couple is concerned their child will be born with sickle cell anemia. The woman does not…
A: Every cell in the human body contains two copies of the haemoglobin gene (apart from eggs and…
Q: Problem: A population of 50 birds contains 16 animals with red tail feathers and 34 animals with…
A: The dominant tail feather color is blue, whereas the recessive color is red. We interpret B as the…
Q: List a controlled variable for each of the following effectors. Hint: think about regulated…
A: Regulated variables help in maintaining homeostasis of body. These are maintained by different…
Q: Identify the component parts of the plasma membrane shown in Figure 1. side cell
A: Plasma membrane is the external boundary of the cell that protects the cell from the exterior…
Q: Endocytosis and exocytosis are both forms of [ ACTIVE / PASSIVE ] transport that [ DO / DO NOT ]…
A: A subfield of biology called cell biology examines the composition, operation, and behavior of…
Q: Select the accurate characterization of neuronal communication. O glutamate binds to AMPA receptors…
A: Electrical and chemical signals are used by nerve cells (neurons), to communicate with each other.…
Q: 1:- Why does diabetic kidneys proximal tubules have thinner walls and reduced brush borders?
A: Since the endocrine system struggles to maintain normal blood glucose levels, diabetics must often…
Q: In the diagram below, Strands I and II represent complementary sections of DNA. The sequence of…
A: DNA deoxyribonucleic acid, is the macromolecule which have two complementary strands that runs anti…
Q: What are the (2) analytical methods would you suggest if your customer requested proof of purity of…
A: Introduction Enzymes are known as biocatalyst. Chemically enzymes are protein. Enzyme increases the…
Q: SIGNALS AND TARGETS. Listed below are sample polypeptides/proteins with their signal…
A: Signal recognisation sequence are the sequence that are responsible for transporting the particular…
Q: Problem 7: Consider the accompanying pedigree of a rare autosomal recessive disease, PKU. I 11 IV a.…
A: Introduction The phenomenon of dominance occurs when one allele (variant) of a gene on one copy of…
Q: Hazardous wastes can be disposed of using Incinerator Injection well Landfill All of the above…
A: Question 14. The activated sludge is a process with concentration of microorganisms, basically…
Q: Explain the events that would lead to uniparental diploidy in an organism
A: A mutation in genetics is an adjustment to the nucleic acid sequence of an organism's, virus's, or…
Q: You are given a bacterial culture which has a concentration of approximately 5.0 x 10^8 cells/mL.…
A: We are given a bacterial culture containing approximately 5.0 x 108 cells/mL. To identify the exact…
Q: Problem 2: The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the…
A: * If the trait is dominant, then one of the parents will have the trait. Dominant traits usually not…
Q: While characterizing a mutation in a gene of interest, you discover that the mutation involves an…
A:
Q: What are the main functions of membranes in cells?
A: Introduction The membrane that surrounds the cell cytoplasm and separated it from the outer…
Q: True or false. The cell walls of plants prevent the process of cytokinesis.
A: Cell division is an essential process of the lifecycle of the cell in which the parent cells are…
Q: VHL ceases to induce the degradation of HIF-1α under which of the following conditions? A.…
A: VHL It is a protein that is involves in cellular functions, which includes the regulation of other…
Q: Are Hydra considered a microorganism? explain.
A: The living organisms are classified according to their characteristics. Based on the different…
Q: what is the relationship Function in General OF Form and
A: Form defines the shape, size and structure of anything. Function is the product of a structure that…
Q: Discuss the chromosomal banding technique
A: Chromosome banding is the straining techniques that is used to visualise the chromosomes under the…
Q: Find an enzyme that is used by humans for some industrial or useful process (apart from its original…
A: Enzymes are proteinaceous substances that work as a role of catalysts by boosting the speed of a…
Q: In a human population of Korfu16% of individuals are Rh-negative. Assuming that this population is…
A: According to Hardy-Weinberg equilibrium the allele and genotype frequences will remain same…
Q: independent of water for reproduction limited to short heights transport of water by diffusion…
A: Mosses : They require a moist environment for reproduction. Their flagellated sperms swim through…
Q: True or False. Non homologous endjoining is more complicated and more precise than homologous…
A: The above given statement is false. Non- homologous end-joining (NHEJ) is more complicated, but not…
Q: a. List genotypes of as many of the family members as possible. b. If individuals A and B marry,…
A:
Q: Gene silencing is mediated by a number of short (~20 nt) noncoding RNAs known as what? - These…
A: Gene silencing It controls gene expression to determine cell fate and also controls metabolism and…
Q: Explain how the transmission of an action potential would be impacted if voltage- gated calcium…
A: The transmission of nerve impulse from one neuron to the next neuron occurs at the synapse that is…
Q: Replication of a circular DNA molecule can occur by either theta () replication or by rolling…
A: Introduction :- Plasmids are tiny circular DNA molecules with a few to over one hundred genes. The…
Q: Wollemia nobilis, family Araucariaceae, phylum Coniferophyta, was discovered recently in a National…
A: Phytopthera cinnamoni is fugus like pathogen which causes severe root infection in many plants like…
Q: Predict which of the following organisms will have the highest percentage of unsaturated fatty acid…
A: Introduction The phospholipids in cell membranes, which are made up of unsaturated fatty acids,…
Q: why are the steps in gram staining are so carefully standardized?
A: Gram staining is very useful process that differentiate bacteria on the basis of their cell wall…
Q: 1. Give two SPECIFIC examples of when, where, and why temperature and pH are important to the…
A: Enzymes are biological catalysts that speed up the rate of chemical reactions. Enzymes are highly…
Q: Problem 8: Which best describes the genetics of the afflicting allele in the following pedigree (it…
A: A pedigree chart shows the inheritance of a trait. It shows all the individuals of different…
Q: What are the four different types of teeth found in heterodontal mammals?
A: Heterodonts are those animals who have different type or classes of tooth present in them and do not…
Q: Describe the principle of a banding technique that can be used to help visualise chromosomes and…
A: Banding pattern enables to view some specific gene rich frequences and chromosomes that are…
Q: The trp repressor binds to the operator region of DNA as a dimer (two repressor protein subunits…
A: The trp operon regulation is a repressible system. When the effector molecule binds to the…
Q: Which of these goals was set out by the agreement known as the Cairo Consensus? a. health-care…
A: In the year 1994, a conference was held in Cario by the International Conference on Population and…
Q: Genetics is a rapidly evolving area of science. Each year advances in genetics bring exciting new…
A: Genetics and biotechnology apply our knowledge of biological processes to develop beneficial…
Q: If you wanted to protect 10 species how large a habitat would you need? In other words, how large a…
A: For 10 species to be protected an area of nearly 10m2 is needed. The maximum species in thsi…
Q: How many muscle fibers can be controlled by one motor neuron? Group of answer choices 6 All of…
A: Motor neurones are brain and spinal cord cells that transmit instructions from the brain to the…
Step by step
Solved in 2 steps
- Which of the following components are required for the polymerase chain reaction (PCR)? Select all correct answers. Group of answer choices dNTPs a restriction enzyme DNA polymerase DNA ligase ddNTPs oligonucleotide primersWhat dna polymerase is used for Sanger sequencingGiven the electrophoresis profile of a Sanger sequencing result, what was the sequence of the original DNA sample used for sequencing? GGTAACC CCAATGG GGTTACC CCATTGG
- What is dideoxy sequencing? Explain it please.After you did the amplification by PCR, you run the product on 2% gel. Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how many grams of the Agarose? Draw a picture (On a paper or on computer) for the gel that you are expecting, the gene that you amplified is approximately 200 bpThe illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/
- Please answer both parts, a. The enzyme that catalyzes the joining of fragments to form recombinant DNA is: Question 21 options: DNA polymerase DNA ligase helicase restriction endonuclease b. In the above diagram, ‘1’ represents the Question 3 options: sticky ends restriction sites primer restriction fragmentsChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHFor the analysis of plasmid DNA samples, ________ that recognize, bind to and cleave DNA at specific nucleotide sequences are used. Question options: primase restriction enzyme. DNA polymerase I. reverse transcriptase.
- schematic diagram for the procedure in doing DNA extraction, isolation and quantificationSelect all the following statements that are correct regarding agarose gel electrophoresis and restriction digests. Group of answer choices A higher percentage of agarose is used to distinguish between smaller pieces of DNA DNA fragments run from the positive electrode (where they are loaded) to the negative electrode Buffer is poured into the electrophoresis chamber AFTER the DNA has been loaded into the lanes. Larger DNA fragments migrate more slowly than smaller DNA fragments Loading dye is added AFTER restriction digests have been completed.You are given the following DNA fragment to sequence:5'-GCTTAGCATC-3'. You first clone the fragment in bacterialcells to produce sufficient DNA for sequencing. You isolate theDNA from the bacterial cells and carry out the dideoxy-sequencingmethod. You then separate the products of the polymerizationreactions by gel electrophoresis. Draw the bands that shouldappear on the gel from the four sequencing reactions.