Which of the following enzymes is needed to produce mRNA?     ligase     helicase     DNA polymerase     RNA polymerase

Q: The palm domain of a DNA polymerase contains the catalytic site of the enzy Ograbs the incoming…

A: Introduction Humans and nearly all other species carry their genetic information in DNA…

Q: In the process of transcription

A:

Q: Which of the following molecules are participate in the steps protein synthesis steps in both the…

A: Introduction :- RNA polymerase creates RNA by following a DNA strand. RNA polymerase is an enzyme…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Fill in the following information for making the following polypeptide (the codon chart is below).…

A: The sequence of nucleotides in DNA or RNA makes up the genetic code. Codons are three-base groups…

Q: REPLICATION TRANSCRIPTION TRANSLATION Molecule or enzyme a) DNA Polymerase a) Ribosomes b) RNA…

A: Replication- DNA replication requires other enzymes in addition to DNA polymerase, including DNA…

Q: DNA ligase

A: The correct option is Option 3. DNA ligase

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: enzymes will form the m-RNA molecule?

A: The correct answer is option d). RNA polimerases II

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: Some Events that May Occur during Transcription RNA polymerases detach. DNA polymerases detach. DNA…

A: DNA or Deoxy ribonucleic acid is the genetic material present in all living organisms. It contains…

Q: Which of the following enzyme is responsible for making a DNA copy from RNA?a) Reverse…

A: Transcription: It is a process in which RNA is synthesized by RNA polymerase using DNA as…

Q: Which of the following statements is TRUE? O DNA polymerase moves in a 5 to 3 direction in…

A: In this question, we have to identify the statement that is true.

Q: When DNA is copied, sometimes a mutation occurs where an incorrect, base pairing appears within the…

A: Introduction :- Two nitrogen-containing bases (or nucleotides) that join to form the DNA structure.…

Q: When a geneticist or microbiologist uses ligase, what is the ligase being used for covalently…

A: DNA ligase is an enzyme that is used to join fragments of DNA by catalyzing the formation of…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: Which domain of the DNA polymerase has a role on correcting the position of the primer and the…

A: Introduction A domain is a specific physical region or amino acid sequence in a protein that is…

Q: RNA- degrading enzyme.

A: RNA is ribonucleic acid. It is single stranded. It has four bases adenine, guanine, cytosine and…

Q: Which of the following is synthesized from a DNA template? (Select one) a. Transducer RNA b.…

A: The short stretch of DNA that serves as a functional unit of heredity is called the gene. The…

Q: In the process of genetic engineering, recombinant DNA is produced by combining genetic material…

A: Recombinant DNA technology consists of techniques that are developed for manipulating, maintaining,…

Q: Which enzyme is used in Sanger sequencing reactions? O A. DNA polymerase O B. S1 endonuclease O C.…

A: Introduction :- Sanger DNA sequencing is commonly employed in research to target smaller genomic…

Q: Transcription is the process of

A: Central dogma is proposed by Francis Crick. Central dogma states that the genetic information flows…

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: Short strands of............. primer are used in DNA replication. DNA RNA Histone

A: DNA replication is essential Because every time a cell splits, the two new daughter cells must have…

Q: A frameshift mutation occurs in a DNA strand. The mutation is a deletion of the two nucleotides…

A: A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: non-coding DNAs can be put into two groups

A: Part of DNA that does not encode a protein sequence is called as non coding DNA. tRNA, rRNA and…

Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Q: A  partial DNA template has the following sequence of nucleotide bases: A-C-G-T-A-C Type the…

A: DNA or deoxyribonucleic acid is the genetic material in all living organisms that is composed of…

Q: The enzyme that removes the RNA primer from the Okazaki fragment is:   DNA pol III   DNA ligase…

A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus…

Q: The enzyme which has a final mistake rate of 1 mistake / 10° nucleotides is enzyme which has a final…

A: Deoxyribonucleic acid (DNA) replication is a biological process in which two identical replicas of…

Q: What do you call the process of making chains of polypeptides out from RNA strand? Group of answer…

A: Nucleic acids are defined as the type of natural chemical compounds that play a major role in…

Q: Show the effect of the following types of mutation on the 5th N-base of the given DNA sequence. Use…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: Which of the following does the enzyme primase synthesize? a. DNA primer b. RNA primer c. Okazaki…

A: Primer RNA is RNA that initiates DNA synthesis. Primers are required for DNA synthesis because no…

Q: Which of the following enzymes is not involved in bacterial DNA replication?   DNA Polymerase III…

A: Bacteria is a prokaryotic organism that do not DNA organised as chromosomes. It lacks well defined…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…

Q: What enzyme replaces the RNA primers on the Okazaki fragments on the lagging strand? DNA Pol II

A: DNA replication is the process by which DNA duplicates itself. One of the most important feature of…

Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA…

A: DNA molecule is the genetic material present in the animals. Genetic material  is present in the…

Q: Which of the following is RNA-dependent RNA polymerase?a) Reverse transcriptaseb) RNA polymerase Ic)…

A: RNA Polymerase is an enzyme that brings about polymerization of ribonucleotides to form RNA. Usually…

Q: The name of the enzyme that cuts the DNA in order to remove a section of broken DNA is called A)…

A: The damaged DNA strand is cut at two points by an enzyme called nuclease, and the damaged segment is…

Q: A change in the base sequence in a DNA molecule is known as replication.…

A: DNA translation is the term used to depict the course of protein formation by ribosomes in the…

Q: Which process occurs with tRNA at the ribosomes? translation transcription…

A:

Q: Which enzyme is used by the bottom daughter strand but not by the top daughter strand? O RNA primase…

A: dna replication is the process by which parent dna makes two daughter strands . the given diagram is…

Q: Some Events that May Occur during Transcription RNA polymerases detach. DNA polymerases detach. DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Which two of the following statements about transcription are true A. Transcription makes an RNA…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…

A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…

Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: Transcription is a process through which the double stranded DNA transcribes itself into a single…

Q: What is the function of reverse transcriptase?

A: BASIC INFORMATION CENTRAL DOGMA  It is basically the process which tell us the unidirectional flow…

Q: What is the function of DNA polymerase a in eukaryotes? lagging strand synthesis leading strand…

A: Replication of eukaryotic cells employs three DNA polymerases: polymerase α, δ, and ε .

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.