Answered: In E. coli, RecBCD complex has (select…

Name: In E. coli, RecBCD complex has(select all correct answers)endonucleas
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In E. coli, RecBCD complex has(select all correct answers)endonuclease activityа.O b. DNA helicase activityO c. ligase activityС.O d. exonuclease activity

Science

Biology

In E. coli, RecBCD complex has (select all correct answers) endonuclease activity а. O b. DNA helicase activity O c. ligase activity С. O d. exonuclease activity

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 9TYU: Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break...

See similar textbooks

Similar questions

Several temperature-sensitive mutant strains of E. coli displaythe following characteristics. Predict what enzyme or functionis being affected by each mutation.(a) Newly synthesized DNA contains many mismatchedbase pairs.(b) Okazaki fragments accumulate, and DNA synthesis is nevercompleted.(c) No initiation occurs.(d) Synthesis is very slow.(e) Supercoiled strands remain after replication, which isnever completed.
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2, (b) bromouracil, and (C) 2-aminopurine.
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers(c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
You desperately need to join two DNA fragments, one with an EcoRl site and the other with a BamHI site.Both enzymes leave 5' overhangs cutting after the first base. EcoR/ cuts at gaattc, BamHI at ggatcc. Whichof the following statements is true? A. You can not ligate these fragments.B. You can remove the overhangs with another restriction and ligate the blunted ends.C. You can fill in the ends with DNA polymerase and ligate the blunt ends.D. This can be done directly as the 5' overhangs anneal.E. You are better to replace EcoR/ with a related enzyme that leaves a ligatable 3' overhang. Please explain why it's C
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2 (b) bromouracil and (c) 2-aminopourine
The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome assembly B. 5’→ 3’ polymerase C. 3’ → 5’ exonuclease and proof-reading D. sliding clamp
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU