Polyadenylate polymerase is specialized in synthesizlng the PulyMRNAS.Which of the following statements about polyadenylate polymerase is correct?It is tethered to RNA polymerase IIO It synthesizes a 80-250nt long stretch of adenines based on the DNA templateIt is a DNA-dependent RNA polymeraseAll of the these

Name: Polyadenylate polymerase is specialized in synthesizlng the PulyMRNAS
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Polyadenylate polymerase is specialized in synthesizlng the PulyMRNAS.Which of the following statements about polyadenylate polymerase is correct?It is tethered to RNA polymerase IIO It synthesizes a 80-250nt long stretch of adenines based on the DN

Polyadenylate polymerase (polyA polymerase) adds polyA tail to the mRNA as a part of the…

Science

Biochemistry

Which of the following statements about polyadenylate polymerase is correct? O It is tethered to RNA polymerase II O It synthesizes a 80-250nt long stretch of adenines based on the DNA template O It is a DNA-dependent RNA polymerase O All of the these

Which of the following statements about polyadenylate polymerase is correct? O It is tethered to RNA polymerase II O It synthesizes a 80-250nt long stretch of adenines based on the DNA template O It is a DNA-dependent RNA polymerase O All of the these

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

The following sequence of nucleotides is found in a single-stranded DNA template:ATTGCCAGATCATCCCAATAGATAssume that RNA polymerase proceeds along this template from left to right a. Which end of the DNA template is 5′ and which end is 3′?b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Which of the enzymes from the following list wouldyou need to make a cDNA library? What is the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
Binding of the prokaryotic DNA dependent RNA polymerase to promoter site is inhibited bya) Rifampicinb) Tetracyclinec) Puromycind) Streptomycin
Which of the enzymes from the following list wouldyou need to make a recombinant DNA molecule? Whatis the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
Role of sigma factor in bacterial RNA polymerase isa) Catalyzing RNA synthesisb) Positioning RNA polymerase correctly on the DNA templatec) Terminating RNA synthesisd) Unwinding DNA template
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
Which is the odd one out ? For the rest, explain the concept/process/technique they are involved with. TFIIH TFIIF RNA polymerase II TFIIE EIF-2
In eukaryotic transcription A. RNA polymerase does not require a template. B. all RNA is synthesiud in the nucleolus. C. consensus sequences are the only known promoter elements. D. phosphodiester bond formation is favored because there is pyrophosphate hydrolysis. E. RNA polymerase requires a primer.
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’3’ direction.