Which of the following things must happen first if DNA is going to be replicated * O DNA gets broken into smaller pieces to make the process more manageable DNA gets unzipped, so the two complimentary strands are separated DNA Polymerase adds on bases that match with the original strand DNA gets wound back into chromosomes so it's ready for mitosis

Which of the following things must happen first if DNA is going to be replicated * O DNA gets broken into smaller pieces to make the process more manageable DNA gets unzipped, so the two complimentary strands are separated DNA Polymerase adds on bases that match with the original strand DNA gets wound back into chromosomes so it's ready for mitosis

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

Which of the following sequences is the best description of the complementary DNA sequence to the following sequence: 5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'
why is recombinant DNA is possible becuase we know dna molecules from all organisms share the same chemical structure and differ only in the nucleotide seqeunce within the identical structure
In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging strand prior to the action ofDNA polymerase I. The lagging strand contains three Okazakifragments. The RNA primers, which are shown in red, have not yetbeen removed. A. Which Okazaki fragment was made first, the one on the left orthe one on the right?B. Which RNA primer will be the first one to be removed by DNApolymerase I, the primer on the left or the primer on the right?For this primer to be removed by DNA polymerase I and for thegap to be filled in, is it necessary for the Okazaki fragment inthe middle to have already been synthesized? Explain.C. Let’s consider how DNA ligase connects the left Okazaki fragmentwith the middle Okazaki fragment. After DNA polymerase Iremoves the middle RNA primer and fills in the gap with DNA,where does DNA ligase function? See the arrows on either sideof the middle RNA primer. Is ligase needed at the left arrow, atthe right arrow, or both?D. When…
Which of the following DNA sequence pairs are completely complementary? Group of answer choices 5’-AGTCTTAGC and 5’-GCTAAGACT 5’-CTGACCTGG and 5’-GGTCCAGTC 5’-TTGATGACC and 5’-TTGATGACC 5’-GAGCTAATA and 5’-GAGCATTAT
Polymerase chain reaction (PCR) is a technique used to amplify (copy) DNA. Suppose a single, linear molecule of double‑stranded DNA (dsDNA) is amplified by PCR. After one PCR cycle, how many molecules of dsDNA will there be? molecules of dsDNA after one cycle: After three PCR cycles, how many molecules of dsDNA will there be? molecules of dsDNA after three cycles:
I need help with a biology lab question, a DNA isolation lab Cold temperatures were used to cause the DNA to flocculate (form larger comples). What was the purpose of adding isoporpyl alcohol to the mixture? Hint: DNA dissolves in water and undissolves in alcohol.
Choose the False answer. Single stranded DNA. a.has a left-handed alpha helical structure. b.does not have defined conformation. c.is formed by thermal dissociation of double stranded DNA. d. is used as a temperature in the replication process. B and d, only All statement are false c, only a, only b only d, only
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of the dsDNA exists in a single stranded (denatured form). b Temperature at which the first dsDNA molecules denatures. c 50% of the dsDNA exists in a single stranded (denatured form). d Temperature at which the dsDNA solution starts boiling.
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
An alien organism was investigated. When DNA replicationwas studied, a unique feature was apparent: NoOkazaki fragments were observed. Create a model of DNAthat is consistent with this observation.