Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 15 Residue Number 2 Hydropathy value -2 0 セー
Q: Which of the statement(s) is/are TRUE? 1. Desaturation is the process of introducing another carbon…
A: Synthesis of Fatty acids occur as acetyl CoA units and NADPH react by the action of enzymes like…
Q: he amino acid alanine, shown below, contains all of the following functional groups except A. an…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Consider the carbohydrate maltose. a. How many molecules of acetyl CoA are formed from its complete…
A: Maltase is the enzyme that transforms maltose into glucose. During digestion, pancreatic or salivary…
Q: Which of the following is MOST soluble in polar solvents? A H3C LOH В с D В OD Oc О А H3C. HO л HC…
A: In the given image, structures A, B, and C represents fatty acids. A is a saturated fatty acid.…
Q: Photorespiration occurs when [O2]/[CO2] is low. Group of answer choices True False
A: Photorespiration is a plant metabolic process in which the enzyme RuBisCO oxygenates RuBP, losing…
Q: Crystal structures exist for three neurokinin-1 (NK1) ligand complexes with the following pdb codes…
A: NK1 is a type of mammalian tachykinin receptors. These are G-protein coupled receptors which are…
Q: Each enzyme has a specific which is the reactant that the enzyme will act upon. Induced Fit Model of…
A: A catalyst is described as a substance that accelerates the rate of a chemical reaction without…
Q: Briefly discuss the effect of salt, pH and temperature on the action of salivary amylase. Then, list…
A: Salivary amylase breaks down complex carbohydrates into smaller pieces. The activity of salivary…
Q: Why do you think you need to add NaCl?
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Part A If one molecule of glucose were to proceed through the citric acid cycle, how many molecules…
A: Glycolysis is the first step in catabolism of glucose. Glycolysis takes place in the cytosol and…
Q: A plot of 1/ versux 1151, called a Lineweaver Burk or double-reciprocal plol, is a useful tool for…
A: Enzymes are proteins that hasten biochemical reactions such that substrate molecules are converted…
Q: Refer to the diagram of the Krebs cycle Which of the Amino acids is able to enter the Krebs cycle…
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Glycolysis is a process in…
Q: If I want to make a 100mL buffer that has 2% SDS, 100mM tris pH 8, 10mM EDTA, and proteinase K…
A: Introduction: Buffer is defined as a solution that resists change in pH on the addition of acid or…
Q: How many nucleotides would be required to synthesize a protein of 60 amino acids? 90 180…
A: Translation is the process by which ribosomes in the cytosol or endoplasmic inner membrane…
Q: For the following three carbohydrates, draw the hawort projection and chair structure
A: D-Glucose, D-Allose, and D-Idose are aldohexoses. These are the monosaccharides. Haworth projection…
Q: Try searching for a way that RNA is used other than for making protein. Does this use involve…
A: Introduction: The structure of RNA is similar to DNA with several key differences. It is made up of…
Q: Which of the following is an inhibitor of gluconeogenesis? citrate O ADP O acetyl COA ATP
A: Gluconeogenesis is a metabolic pathway which participates in the synthesis of glucose. Through this…
Q: Consider the following diagram of the cell membrane. Which of the statements is NOT true regarding…
A: The fluid mosaic model of the cell membrane describes the plasma membrane to be a mosaic of…
Q: A3 Glucosylacetamide has a structure similar to the transition state during catalysis by the enzyme…
A: The chemical compounds that have structure similar to that of transition state substrate are called…
Q: Kevin was experiencing heartburn prior to his heart attack, for which he was taking an antacid…
A: In the antacid tablets, calcium carbonate acts as an active ingredient. This ingredient is…
Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA…
A: DNA replication is the process of duplication of a DNA into two daughter DNAs. Each strand of the…
Q: Match the following events in protein synthesis Prompts is the central reaction of protein…
A: Since there are 4 option based questions we will answer all the questions.
Q: 1. Arabinose is a pentose and an aldose 2. Glucose-6-phosphate cannot leave cell because its size is…
A: The Arabinose is a type of sugar or saccharide ,it is further classified as monosaccharide . Glucose…
Q: What is the hydroxide ion concentration in a solution that containing 0.30 mole of ephedrine and…
A: This buffer system is made up of ephedrine base and its salt ephedrine hydrochloride. The hydroxide…
Q: Which of the following is not an inhibitor? a. CO b. Magnesium ion c. sulfa drugs d. cyanide e.…
A: Introduction: Inhibitors are compounds that reduce the rate of chemical reactions. It can also act…
Q: Acetyl-CoA, AG" = -7.7 kcal/mol CoA Oxaloacetate Citrate AG" = ? AG"=-1.5 kcal/mol Isocitrate Krebs…
A: The tricarboxylic acid (TCA) cycle, or the Krebs or citric acid cycle, is the primary source of…
Q: e. Triacylglycerols and glycerophospholipids both contain fatty acids and saponifiable. True False…
A: Triacyl glycerols are the esters of fatty acids attached to Glycerol. GlyceroPhospholipids are…
Q: What did you learn about the uses of nucleic acids? 3- Three things I learned about how nucleic…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: Determine the OPTIMUM pH for the enzyme reaction using the software simulation: (HINT: Run the…
A: Enzymes are the biocatalyst which increases the rate of reaction without itself being changed in…
Q: Which of the following is not true? There are two major classes of aminoacyl-tRNA synthetases…
A: Central dogma includes three main processes Replication, Transcription, and Translation.…
Q: 1. Where many select ▾ processes take place in the cell? select 2. Cell control center select 3. The…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: II. Provide the chemical formula for each of the following compounds. 1. sodium sulfate 2. sodium…
A: Chemical formulae are a way to represent any chemical compound using the symbols for the components…
Q: 3. Draw the structure of a protein containing 3 amino acids and then explain the process of…
A: Proteins are a class of complex macromolecules essential for the human body. Proteins are formed by…
Q: What role do aurora kinase play in the cell cycle and how would using these kinases as target for…
A: A particular series of events undertaken in proper time frame inside different types of cells when…
Q: A plasmid comprised of B-DNA changed its linking number from 420 to 457, resulting in a superhelix…
A: Introduction: DNA in the cell must be arranged in order to allow the packing of large DNA molecules…
Q: Please don't copy Chemistry All of the following tend to favor a helical conformation of a single…
A: Introduction: A longer nucleic acid is called a polynucleotide. It is a biopolymer composed of…
Q: rearrange these in the correct order of events in an action potential.
A: The process of impulse transmission involves two stages known as resting membrane potential and…
Q: Name of the vitamin source of CoASH A. B12 B. B3 C. B9 D.B1 E. B7
A: Some enzymes are dependent on cofactors for their enzymatic activity. There are two types of…
Q: Does a carbohydrate rich meal promotes glycogenesis?
A: The method of producing glycogen from glucose is known as glycogenesis. Glycogenesis is the process…
Q: lanosterol
A: The formation of cholesterol through different biological components is called cholestrol…
Q: 1. On a hot day a tourist in the wilderness could not find a source of drinking water for a long…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: Explain how oxygen dissociation curve shifts affect oxygen loading in the lungs and unloading at the…
A: Introduction: Hemoglobin is a globular protein with four polypeptide chains bonded together. It has…
Q: The graph below shows the O₂-binding curves for myoglobin (Mb) and hemoglobin (Hb). a. 100 80 60 40…
A: Introduction: Oxygen binding is the binding of an oxygen molecule to a specific functional protein…
Q: Which of the following is not involved in cyclic cyclic photophosphorylation? Group of answer…
A: During photosynthesis the photoexcited electron that is energized by light passes from the primary…
Q: Statement A hexose sugar Insoluble in water Formed by condensation reactions Contain the elements,…
A: The biological macromolecules nucleic acids, proteins carbohydrates and lipids form the building…
Q: Please state if the statements are true or false. 1. Ribulose is a pentose and a ketose 2. GTP…
A: Since you have posted multiple questions we will answer the first question for you. If you want any…
Q: Name and explain in detail one pathological condition/state in which the activity of succinate…
A: The citric acid cycle and the respiratory electron transfer chain contain succinate dehydrogenase.…
Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…
A: The central dogma of molecular biology outlines the flow of genetic information within a biological…
Q: All the reactions involved during gluconeogenesis occur in the cytosol except the one catalyzed by…
A: Gluconeogenesis is the process of synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: The following carbohydrate tests have been performed on each of the following sugar standard…
A: Qualitative tests are those that measure the presence or absence of a substance. The qualitative…
Step by step
Solved in 2 steps
- A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?1) In MALDI-TOF data, when performing peptide mass mapping search, a) The number of peptides matched decreases from 13 to 11 and the sequence coverage decreases to 47%, but the protein score increases from 111 to 124. Explain. b) The nnumber of 11 peptide masses matched and the sequence coverage is 47% (same as in part a), but the protein score increases to 157. Explain.Chymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C-1 G-A-E-A-T-E C-2 G-K-V-G-A-H-A-G-E-Y C-3 V-L-S-P-A-K-T-N-V-K-A-A-W What is the sequence for the peptide? NOTE: Label the fragments when reconstructing the peptide chain e.g. for trypsin T-1, T-2 etc...
- The sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino-terminal is Val. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T-1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E T-2 A-A-W-G-KT-3 V-L-S-P-A-K T-4 T-N-V-Kusing, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?Please help! Sketch a titration curve of the peptide Ala-Tyr-Gln-Met-Asp-His from pH=0 to 14 up to 5 equivalnets of KOH (Please type answer)
- Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Sir Bong wanted to determine the a amino acide sequence og BONG. The summary of the analyses performed to the peptide is attached. 1. The three letter designation for the N terminal amino acid residue of CUTE is? 2. The three letter designation for the N terminal amino acid residue of POGI is? 3.The three letter designation for the N terminal amino acid residue of BONG is? 4. The ONE letter designation for the N terminal amino acid residue of CUTE is? 5. The ONE letter designation for the N terminal amino acid residue of POGI is? 6. The ONE letter designation for the N terminal amino acid residue of BONG is? 7.The ONE letter designations for the fragments produced upon treatment of POGI with chymotrypsin are? 8. The ONE letter designations for the fragments produced upon treatment of BONG with thermolysin are?Explain how tandem mass spectroscopy is used to determinethe sequence of a peptide. Once a peptide sequence is known,how is this information used to determine the sequence of theentire protein?
- Identify and briefly describe three different PEGylation strategies you can use to PEGylate this peptide and draw the chemical structure of the resulting mPEG peptide conjugatesConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?You are trying to determine the PTMs on your protein of interest, so you set up a mass spectrometry experiment. You get the following data. Starting sequence: PRTEINSKICKASSDER After Trypsin digest, you get the following major peptides and weights from MS: TEINSKICK/1167 Da ASSDER/664 Da a. Which of these peptides is modified? b. What is the modification?