Why might the compound shown below act as a transition state analog of phosphoglucose isomerase? A drawing of the normal transition state for this enzyme is needed.

Q: How will a graph of reaction rate (V) vs. [substrate] for an allosteric enzyme differ from the…

A: The enzymes are biochemical catalysts that enhances the rate of biological reactions.  Most enzymes…

Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…

A:

Q: ATP stock (50 µM): Make pre-dilutions with 20, 15, 10, 5, 2,5 and 1,25 µM ATP (1000 μL of each)…

A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…

Q: General ways of metabolism; catabolic, anabolic and amphibolic reactions.

A: The total number of biochemical processes that keep a biological organism's cells functioning…

Q: Canonical forces in protein folding. Describe how these forces come into play when a protein folds.

A: INTRODUCTION : Canonical forces in protein folding - Canonical forces are those forces which…

Q: The value of kcat for N-Ac-Phe-OC₂H5 is two-fold greater than that for the L-tryptophanyl analog and…

A: Chymotrypsin catalyzed peptide bond hydrolysis takes place in 2 phases after the enzyme binds the…

Q: DNA: Explain the Meselson-Stahl Experiment.

A: The mode of replication in DNA, in which a parental duplex DNA gives rise to two identical daughter…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: HN 2 H₂N-C C 6 3 N C 5 C following nitrogenous bases is represented by this structure? 7 ZI 8 CH

A: The nucleic acids are constituted of nucleotides.  The nucleotides consist of a base (adenine,…

Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…

A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…

Q: Identify the type of chemical reaction. 1 R R 2 Fat / Oil C01695 -R 3 NaOH/H₂O heat Lye Linoleic…

A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…

Q: Dehydrogenase reactions in TCA cycle

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…

Q: What are the roles of the other enzymes involved in replication and why they're necessary ?

A: Before cells divide, DNA replication must occur. DNA replication is the complete, faithful copying…

Q: What is acid-base homeostasis?

A: Homeostasis is the ability of an organism to regulate its internal environment in varying external…

Q: Why doesn't the enzyme bromelain digest the proteins in your stomach when you eat fresh  pineapple?

A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…

Q: Which carbohydrate test can you use to distinguish a monosaccharide from a disaccharide? hexoses…

A: A carbohydrate is a biomolecule which consists of carbon, hydrogen and oxygen atoms. The hydrogen…

Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…

A: Nonessential amino acids can be synthesized in the body in which the cells provide the carbon…

Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: What compound of phosphorus is found in nucleic acids?  What are the products of hydrolysis in RNA…

A: DISCLAIMER FOR MULTIPLE  Since you have asked multiple question, we will solve the first question…

Q: In the liver, what is the major regulation that dictates fate of pyruvate vs lactate? (This can tie…

A: Pyruvate that is produced as the end product of glycolytic pathway is converted into acetyl CoA…

Q: Why only distilled water used as a solvent for the DNA molecules? What is the characteristic of the…

A: DNA stands for deoxyribonucleic acid, it is a genetic material found in all cells. It is basically a…

Q: 1. The second high energy intermediate metabolite of glycolysis that can be used for substrate level…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The diagram to the right illustrates the inter-actions of the amino acid side chains of two…

A: Coiled coils are super secondary structures formed as 2 or more alpha helices twist around each…

Q: dideoxy sequencing

A: Identifying the precise order of nucleotides, or bases, in a DNA molecule is done using a standard…

Q: In a hydrogen fuel cell, hydrogen gas and oxygen gas are combined to form water. Write the balanced…

A: Water molecule is a compound formed from hydrogen and oxygen gas. It has two Hydrogen atoms and one…

Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…

A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…

Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.

A: Catabolism is one is the steps of metabolism in which complex compounds are hydrolysed into simpler…

Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…

A: Glycolysis: The process through which glucose is broken down to create pyruvate in a cell's…

Q: ONE of the two amino acids that has a side chain including the modified carboxyl group, carboxamide,…

A: Amino acids are the building blocks of proteins. Amino acids are classified into polar and non polar…

Q: Relate the molecular properties to physicochemical properties of the following lauric acid stearic…

A: Lipids are chemically diverse group of biomolecules that have two common properties: they are…

Q: What are the 3 steps of amino acid degradation:

A: Amino acids are biomolecules that act as the building blocks of proteins. Biologically important…

Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…

A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…

Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…

A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…

Q: You measure Protein A and Protein B to have a Kd of 10-8 M. At what concentration of Protein B will…

A: Here we have 2 proteins, 'A' and 'B' . The reversible equilibrium between these 2 proteins is shown…

Q: Given the following standards and the corresponding standard curve table, what is the amount of…

A: The enzymes are protein molecules that increase the rate of reactions by decreasing the activation…

Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…

A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…

Q: Which pathways use substrate-level phosphorylation and which use oxidative phosphorylation?

A: Substrate-level phosphorylation is a metabolic process that involves the direct transfer of a…

Q: Two compartments are separated by a semipermeable osmotic membrane through which only water…

A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…

Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…

A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…

Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.

A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…

Q: Although initiation requires the sigma factor or sigma subunit be associated with the core RNA…

A: Transcription is a process by which RNA is synthesized using DNA as template. Transcription occurs…

Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?

A: Stock solution is the given solution present in lab. From the stock solution, we make the working…

Q: Biochemical events in the synthesis of ATP: I. Subunits of ATP synthase chages in conformation and…

A: ATP synthase is a complex enzyme consists of an F0 and F1 components. It uses the proton motive…

Q: Lipogenesis, or fatty acid synthesis, occurs in several cycles. A diagram of the reactions of the…

A: De novo synthesis of fatty acids takes place in the cytosol of all eukaryotes. Fatty acids are…

Q: Which one of the following is found at the 5' end of eukaryotic mRNA?

A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…

Q: QUESTION: For each enzyme identify the transition-state inhibitor analog by drawing a circle around…

A: Whenever a reaction takes place there are reactants and they form products but in between, during…

Q: DNA: Whats the difference between continuous and discontinuous synthesis, why replication requires…

A: DNA is Deoxyribo Nucleic acid which functions as genetic material in most of the organisms.…

Q: 4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.

A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…