4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the anticodon of the tRNA interacts with its cognate codon on mRNA (you do not need to draw out the bases and their exact hydrogen bonding patterns; instead, you can just use the single letter abbreviations for the bases). Where is the anticodon located in the tRNA molecule? Where is the amino acid attached to the tRNA? Your illustration can include the overall general structure of a tRNA to address these questions.

4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the anticodon of the tRNA interacts with its cognate codon on mRNA (you do not need to draw out the bases and their exact hydrogen bonding patterns; instead, you can just use the single letter abbreviations for the bases). Where is the anticodon located in the tRNA molecule? Where is the amino acid attached to the tRNA? Your illustration can include the overall general structure of a tRNA to address these questions.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
Q1: How many codons code for isoleucine? For tryptophan? For leucine? Q2: What codons are associated with asparagine? With serine? Q3: From the partial mRNA sequence that you speciﬁed in Figure 10.6’s question 3 as being transcribed from the DNA template strand, remove only the ﬁrst A. What amino acid sequence would be translated as a result of this change? How does that sequence compare to the amino acid sequence you translated from the original mRNA sequence?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'
Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct
4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
1.) if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of nucleotide base pairs needed to code for B-globin? 1a.) How many mRNA codons does this correspond to?