Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of this difference?

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: How Translation of mRNA Depends on Ribosomes and Transfer RNAs ?

A: Translation occurs in four phases: activation (prepare), initiation (start), elongation(make longer)…

Q: The codons UGA, UAA, and UAG do not code for amino acids. What is their role as codons in mRNA?

A: Amino acids are the basic structural units or building blocks of proteins. Amino acids are used for…

Q: List and draw out four distinctive features of most eukaryotic mRNAs.

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…

A: The translation is a process in which the genetic information in the mRNA strand is converted into…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: what is c-abl mRNA

A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…

Q: Which peptide is the least likely to be made on the ribosome and why?

A: Ribosomes are composed of two subunits, the large and the small subunit, both of which consist of…

Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…

A: With the help of translation process protein forms. The nucleotide sequence are translated into…

Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…

A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…

Q: Given this MRNA strand: 3 - AUGAGGAAGGUA - 5"; what are the components of the polypeptide?

A: The polypeptide is formed by decoding the triplet codons using the codon table given.  The mRNA…

Q: the sequences od tRNA and corresponding mRNA  is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide…

A: Ribosomes are sphere-shaped structure present within the cytoplasm of a cell. They are composed of…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: A hypothetical tripeptide Leu-Leu-Leu could be synthesized by the cell. What three different base…

A: Nucleic acids are made up of nucleotides. Ribonucleic acid and Deoxyribonucleic acid are polymers…

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…

A: The protein translation is the process of the formation of proteins from the mRNA formed from the…

Q: What role does the poly(A) tail play in mRNA function?

A: Polyadenylation is a process in which poly (A) tail is added to the 3' end of the newly synthesized…

Q: How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that…

A: The translation is a process of conversion of mRNA into specific amino acids in the cytoplasm of a…

Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'

A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…

Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…

A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…

Q: True or false: A fully assembled 70S ribosome is recruited to the mRNA just 5 ́ of the translation…

A: The translation begins with the attachment of messenger ribonucleic acid (mRNA) with the ribosome.…

Q: Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?

A: Protein synthesis involves translation of mRNA into a protein that requires three complex stages,…

Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: why is RNA important in a physiology standpoint, and why is it important to know about this for…

A: RNA is Ribose nucleic acid. Its main building block is a nucleotide which is made up of a ribose…

Q: UGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from…

A:

Q: Some mutations that do not alter the identity of the encoded amino acid lead to diminished…

A: A mutation is an alteration in the nucleotide sequence of the genome of an organism, virus, or…

Q: What amino acid sequence does the following mRNA nucleotides sequence specify?  5'- AUGGCCAGCUGU…

A: Protein is synthesized via translation of mRNA template by ribosomes in the cytoplasm. mRNA has…

Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA…

A: DNA => mRNA => Protein 64 codons are there for 20 amino acids. That is one amino acid can be…

Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: What codon is present near the 3′ 3end of all mRNA molecules?

A: Messenger RNA ( mRNA), this name was proposed by Jacob and Monod. It is always single stranded…

Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…

A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but  10…

Q: Eukaryotic transcription and translation are similar in that both result in synthesis of

A: Answer: EUKARYOTIC = These are the organisms which have organelles present in the cell.

Q: What are the “protein synthesis factories?” Give an overview of the relationship between these…

A: Answer: The process of translating mRNA in to long chains of amino acids , proteins in the subunits…

Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…

A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.