what is the difference between leader mRNA and attenuator sequence? Please explain the function of attenuator sequence in attentuation

Q: Explain why RISC binds to a specific mRNA. What type of bonding occurs?

A: The gene expression regulation in a cell to inhibit the expression of particular genes is called…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: Does crude mRNA have density? if so what is the density value ? Thank You

A: Introduction mRNA is single stranded RNA. Which carries genetic information from DNA to ribosomes…

Q: Aminoacyl-tRNA synthetases are the only component of gene expression that decodes the genetic code.…

A: The protein synthesis involves the synthesis of the polypeptide chain which is catalyzed by several…

Q: Compare and contrast the formation of mRNA in bacterial and eukaryotic cells. How do the differences…

A: DNA is the carrier molecule of all the information that is passed on from parents to offsprings. The…

Q: Draw a general structure of a mature mRNA

A: mRNA is a single-stranded RNA that contains a genetic sequence and it encodes for a protein. It is…

Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…

A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…

Q: Describe the three major modifications that occur duringthe processing of an mRNA.

A: the three major modifications that occur during the processing of an mRNA are :

Q: During transcription, what will the order of bases be in mRNA, if the base sequence of the coding…

A: ans is... CUAGCU

Q: Explain why knowing the orientation of a promoter is critical when determining the amino acid…

A: Promoters are nucleotide sequences of deoxyribonucleic acid that potentially modify binding of RNA…

Q: what is c-abl mRNA

A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are  primer widely used for cDNA the synthesis generation of a high frequency of…

Q: Describe in discrete steps how a polyadenylation signal contributes to the formation of a mature…

A: Answer: Introduction: Eukaryotic cellular process is regulated in the transcription process and RNA…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The translation is a process in which the transcribed messenger RNA (ribonucleic acid) is decoded by…

Q: During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how…

A: The pre-mRNA is composed of two regions, one is the intron, and the other is the exon. The…

Q: Transcription occurs at a rate of about 30 nucleotides per second. is it possible to calculate the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What is the principal difference between the binding ofsiRNA and miRNA with mRNA?

A: siRNA are also known as small interfering RNA or silencing RNA. These are double stranded non-coding…

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: What features do mature eukaryotic mRNA molecules have that bacterial mRNAs lack?

A: The process associated with the formation of mRNA (messenger ribonucleic acid) from DNA…

Q: Eucaryotic

A: Introduction:-  Heterogeneous nuclear RNA or hn RNA is a term that encompasses various types and…

Q: In bacteria, single polycistronic MRNA encodes for:

A: This question is based on polycistron.

Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…

A: Following amino acid sequence is predicted.

Q: What is the evidence that some mRNAs are directed to accumulate in specific subcellular locations?

A: mRNA is te transcribed product of the DNA and has an important role in defining the genetic…

Q: Using what is known about the location of introns, a methylguanosine cap, and a poly-A tail, the…

A: Answer.  In eukaryotes, transcription, and translation take place in different compartments of…

Q: What role does the poly(A) tail play in mRNA function?

A: Polyadenylation is a process in which poly (A) tail is added to the 3' end of the newly synthesized…

Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…

A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…

A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…

Q: Describe the significance of a 5 cap poly A tail on the mature mRNA

A: mRNA- is a coding sequence of a gene implicated in the synthesis of protein, approximately, 4% of…

Q: Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural…

A: Messenger RNAs (mRNA) are the carriers of genetic information from DNA to proteins. The information…

Q: Determine which amino acid is formed from the following mRNA codon: GUA.     a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…

A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…

Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: a) What is the region of the MRNA with all of the X's in this image called?

A: Translation is the process of formation of amino acid sequence using messenger RNA as a template and…

Q: Why does a bacterial mRNA bind specifically to the small ribosomal subunit?

A: The ribosome is a very complex structure, whose machinery is broadly divided into larger and smaller…

Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: A codon is represented by group of three nucleotide sequence of DNA or RNA belonging to a single…

Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: Alternative splicing of the same pre-mRNA produces two isoforms.

A: 30) During RNA splicing , the introns are precisely excised and exons are ligated together. However…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…

Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…

A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…

Q: Prokaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery?…

A: Translation is synthesis of protein from the m-Rna and this occurs in the cytoplasm as all the…

Q: Discuss the advantages, in terms of protein structure and evolution, that result from alternative…

A: Alternate splicing allows a single gene to code for multiple proteins. The protein translated from…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.