will synthesize the in short pieces that are linked together by the enzyme , but the is made continuously during DNA replication. RNA polymerase DNA polymerase primer primase helicase question will save this response. ligase leading strand template strand lagging strand promoter
Q: The enzyme used to join bits of DNA isa) DNA polymeraseb) DNA ligasec) Endonucleased) Primase
A: The process in which deoxyribonucleic acid (DNA) forms the its copy during cell division is known as…
Q: Which of the following statements is true regarding DNA replication? Select all true statements. DA…
A: DNA replication is a process by which two identical copy of DNA is produced from single original DNA…
Q: Directions: Below is a more in-depth look at a replication bubble. All of the parts are still the…
A: DNA replication is the process of formation of new DNA strands over the parent strand of DNA acting…
Q: Which of the following needs to be primed only once during DNA replication? The leading strand. O I.…
A: The replication is the process through which a ds (double-stranded) Deoxyribonucleic acid (DNA) is…
Q: The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show…
A: In DNA replication the replication fork is an active area. When DNA helicase unwinds the double…
Q: Unzipped Single Strand of DNA Complementary Strand of DNA Build the complementary strand of DNA to…
A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid (RNA) and…
Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…
A: DNA replication is the biological process where a double-stranded DNA molecule is copied or…
Q: The palm domain of a DNA polymerase contains the catalytic site of the enzy Ograbs the incoming…
A: Introduction Humans and nearly all other species carry their genetic information in DNA…
Q: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA sequence:…
A: Process by which DNA is copied to mRNA is called transcription. Process by which mRNA is used to…
Q: Match each statements below with the appropriate letter from the replication fork diagram. 1.…
A: 1. Removal of RNA primers and joining of Okazaki fragments. Because of its 5′ to 3′ exonuclease…
Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…
A: For making complementary strand ,we need to follow base pairing rule . Base pairing rule :…
Q: leading strand Primase begins RNA polymerization de novo. lagging strand DNA polymerase synthesizes…
A: The DNA replication starts with some enzymes that cut the strands from one side and attached them…
Q: Okazaki fragments O are short DNA fragments are intermediates in DNA replication begin with a short…
A: Okazaki fragments are a short sequence of DNA nucleotides. The answer is given in step 2.
Q: of a gene are (is) used as the template for RNA synthesis. a sense strand antisense strand both…
A: The process of synthesis of a Daughter stand from the parental DNA strand is called replication.…
Q: iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome…
A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.Most…
Q: Which statement about DNA clamps is TRUE? OThey prime synthesis of DNA. They form ends of eukaryotic…
A: The clamp protein actually helps in the binding of DNA polymerases during DNA replication.
Q: Cells exposed to ultraviolet light develop thymine dimersand visible light reverses this damage.…
A: Irradiation by the UV light causes pyrimidine dimers. The most common pyrimidine dimers formation is…
Q: DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template…
A: The DNA strand which functions as template for RNA synthesis is known as template strand, minus…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: Rolling circle replication is used to copy the bacterial chromosome. plasmids and some…
A: Phage uses most of the host cell machinery to replicate its genome. Its genome contains a minimal…
Q: Short strands of............. primer are used in DNA replication. DNA RNA Histone
A: DNA replication is essential Because every time a cell splits, the two new daughter cells must have…
Q: Acts at oric to initiate DNA replication by denaturing dsDNA Choose... Counteracts topological…
A: DNA replication is a complex process which involves replicating another strand of DNA according to…
Q: DNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are…
A: DNA, deoxyribonucleic acid is a double helical molecule present in the cell which carries genetic…
Q: i) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product…
A: DNA It is defined as a genetic material which has all the stored genetic information of an…
Q: Only silenced DNA is wrapped around nucleosomes, active DNA is loose in the nucleus.
A: DNA silencing is the regulation of gene expression in a cell to prevent the expression of a certain…
Q: e correct order of the Phases of replication
A:
Q: On the right of the replication fork, which DNA strand (top or bottom) will be the template for…
A: Okazaki Fragments these are short stretches of DNA produced by a discontinuous synthesis of the…
Q: Which of the following enzymes remove supercoiling in replicating DNA ahead of the replication…
A: The DNA is in the form of a circular molecule. The DNA is right-handed helix and consists of some…
Q: The discontinuous aspect of replication of DNA in vivo is caused by trinucleotide repeats lack of…
A: Replication of DNA in vivo is described as semi discontinuous. This is because DNA replication takes…
Q: DNA polymerase III adds a nucleotide to the 3' end of the strand. leading strand. All of the answers…
A: Concept used: DNA Replication DNA Replication : The process where the strands of DNA are…
Q: DNA polymerase separates the two strands of the relaxed DNA helix; the point of separation is the…
A: a. DNA replication is the biological process of producing two similar copies of DNA from one…
Q: he up with one word, seven letter or more, that can be spelled using only the one letter…
A: Synthesis of proteins from RNA is called translation and synthesis of RNA from DNA is called…
Q: Which of the following is not necessary for replication to proceed? O MRNA RNA primer DNA polymerase…
A: The answer is m-RNA.
Q: Primase has the important role of removing the RNA primers and filling the gaps with new DNA…
A: DNA replication There are number of processes necessary for the continuation of generation, growth…
Q: Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer…
A: DNA is the genetic material of almost all the organisms, except few viruses and is present in the…
Q: A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] .…
A: The DNA replication is the process by which new DNA is synthesized from the old DNA by…
Q: Why is an RNA primer necessary for DNA replication a. The RNA primer is necessary for the activity…
A: DNA Replication: It is a process by which DNA makes a copy of itself during cell division. The…
Q: Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication…
A: The compounds known as nucleotides are made up of a nitrogenous base, a phosphate group, and a sugar…
Q: The DNA polymerase involved in base excision repair isa) DNA polymerase αb) DNA polymerase βc) DNA…
A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…
Q: Click on your screen over the DNA polymerase III enzyme depicted on the lagging strand. Replication…
A: Introduction : DNA replication is the process through which daughter DNA is formed from parental…
Q: The lagging strand being more highly methylated than the leading strand. Ligase interfering with the…
A: The cyclical recurrence of multiple separate reactions in a specific sequence, including priming of…
Q: Figure 3 shows a replication bubble. The small black box in the bubble represents a primer. New DNA…
A: DNA replication does not start at random location but ate particular sites, called the origins of…
Q: Which of the following statements are true about DNA polymerase? Select all that apply. O On the…
A: Polymerases are enzymes that catalyze the synthesis of DNA or RNA polymerase whose sequence is…
Q: t the following steps of DNA replication in order. Each new double strand of DNA winds into a double…
A: DNA ( Deoxyribonucleic acid ) replication is a process of making DNA from a template strand of the…
Q: A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] .…
A: *DNA replication is a process which produces two identical replicas of DNA from original DNA…
Q: What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication?…
A: DNA replication is a process that involves the formation of a new identical DNA strand from an…
Q: DNA polymerase III requires a(n)__________ for synthesis of DNA to occur A- DNA template B-RNA…
A: DNA polymerase III binds with the primers on the leading and lagging strand and synthesize new DNA…
Q: A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA…
A: DNA is the genetic material which stores all the biological information. It helps transmitting…
Q: A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase…
A: The replication fork * is a region where a cell's DNA * double helix has been unwound and separated…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?Determine the complementary strand of DNA that forms on this template DNA fragment during replication: 5′GGTTTCTTCAAGAGA3′Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
- Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template of DNA that pairs with the coding strand
- A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…Which of the following statements about replication is false? The proofreading function of DNA polymerases involves 3’ 5’ exonuclease activity. Origins of replication are rich in G-C nucleotide pairs. A characteristic of aging cells is that telomeres become shorter. The lagging strand is synthesized in the opposite direction as the movement of the replication fork. DNA polymerase is more accurate that RNA polymerase.Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHBest DNA repair system to fix - Depurination - Replication Slippage - Deanimation of Cytosine - Double stranded dna break outside of S-phaseWhich of the following enzymes remove supercoiling in replicating DNA ahead of the replication fork?a) DNA polymerasesb) Helicasesc) Primasesd) Topoisomerases