Write the syntax for defining a for loop (loop index j) that counts backwards from 10 to -10 in steps of 2 and prints the current loop index to screen.

In C++

What is a "foreach" loop?

Define the terms sentinel, break, and continue that are used in loop structures. Write in complete sentences

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

c++ language using just one for loop

What is the primary difference between a foreach loop and a traditional for loop in programming?

C++ programming

When you move the pointer too quickly, a phenomena known as submarineing happens when the cursor vanishes.

Given the array initialization int alpha[5] = {100, 200, 300, 400, 500}; Write the loop to produce the output 400 300 200 100explain please C++