You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during absorptive state. q: Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5-recognition site and a 3`- HindIII in the MCS?

You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during absorptive state. q: Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5-recognition site and a 3`- HindIII in the MCS?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not morethan 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for thefollowing questions?1) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide genefrom the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 whichhas a 5-recognition site and a 3- HindIII in the MCS?
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not morethan 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for thefollowing questions? ) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5-recognition site and a 3- HindIII in the MCS?
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. q1 : How can you guarantee a high expression of your protein in any expression vector? answer please
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? ( please answer all part 1, 2 and 3 ) 1) Which tube from the three is the most appropriate to use and why? 2) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5′-recognition site and a 3′- HindIII in the MCS? 3) How…
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during absorptive state. 1) Which tube from the three is the most appropriate to use and why? 2) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5¢-recognition site and a 3¢- HindIII in the MCS? 3) How can you guarantee a high expression of your protein in any expression vector?
you are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not more than 2 pages provide answers for the following question? Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5¢-recognition site and a 3¢- HindIII in the MCS?
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not morethan 2 pages provide answers for the following questions? 1) Which tube from the three is the most appropriate to use and why? 2) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5-recognition site and a 3- HindIII in the MCS? 3) How can you guarantee a high expression of your protein in any expression vector?
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulin C-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolated from pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purified mRNA isolated from pancreatic α-cells from a patient during the absorptive state. The third tube contains purified mRNA isolated from pancreatic β-cells from a patient during the absorptive state. provide answers to the following questions? 1) Which tube from the three is the most appropriate to use and why? 2) Describe the primary procedure(key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open usingEcoR1which has a 5¢-recognition site and a 3¢- HindIII in the MCS? 3) How can you guarantee a high expression of your protein in any expression vector?
A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Under low tryptophanyl-tRNA (tRNAtrp), we expect the trp operon to be expressed because: Question 13 options: Sections 1 and 2 of the leader form a hairpin that acts as a transcriptional terminator. Sections 2 and 3 of the leader form a hairpin that prevents the formation of a transcriptional terminator. Sections 1 and 2 of the leader form a hairpin that prevents the formation of a transcriptional terminator. Sections 2 and 3 of the leader form a hairpin that acts as a transcriptional terminator. Sections 3 and 4 of the leader form a hairpin that acts as a transcriptional terminator.
NASA has identified a new microbe present on Mars and requests that you determine the genetic code of this organism. To accomplish this goal, you isolate an extract from this microbe that contains all the components necessary for protein synthesis except mRNA. Synthetic mRNAs are added to this extract and the resulting polypeptides are analyzed: Synthetic mRNA Resulting Polypeptides AAAAAAAAAAAAAAAA Lysine-Lysine-Lysine etc. CACACACACACACACA Threonine-Histidine-Threonine-Histidine etc. AACAACAACAACAACA Threonine-Threonine-Threonine etc. Glutamine-Glutamine-Glutamine etc. Asparagine-Asparagine-Asparagine etc. From these data, what specifics can you conclude about the microbe’s genetic code? What is the sequence of the anticodon loop of a tRNA carrying a threonine? If you found that this microbe contained 61 different tRNAs, what could you speculate about the fidelity of translation in this organism?