You can successfully synthesize ovalbumin protein (eukaryotic) in the laboratory, with all the necessary components for translation in vitro. To further study translation, you vary some of the conditions and observe significantly lower level of ovalbumin protein production. Which of the following options could be a reason for this observation? Select all that apply. Ovalbumin mRNA is missing the 5'-cap chemically. modified GTP that cannot be hydrolyzed is added Ovalbumin mRNA has a mutated Shine-Dalgarno sequence Methionine charged tRNA has not been added

You can successfully synthesize ovalbumin protein (eukaryotic) in the laboratory, with all the necessary components for translation in vitro. To further study translation, you vary some of the conditions and observe significantly lower level of ovalbumin protein production. Which of the following options could be a reason for this observation? Select all that apply. Ovalbumin mRNA is missing the 5'-cap chemically. modified GTP that cannot be hydrolyzed is added Ovalbumin mRNA has a mutated Shine-Dalgarno sequence Methionine charged tRNA has not been added

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Please use Transferrin receptor as an example of the protein whose pathway is being traced. If it is easier or possible, can there be a labeled drawing to explain.
Identify the correct recognition site for ribosomal subunit binding during translation. the 30s subunit binds to the 7-methylguanosine cap at the 3’ end of eukaryotic mRNA the 60s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eubacterial mRNA the 40s subunit binds to the 7-methylguanosine cap at the 5’ end of eukaryotic mRNA the 70s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eukaryotic mRNA the 50s subunit binds to the 7-methylguanosine cap at the 3’ end of eubacterial mRNA
An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)
Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? A - during initiationB - during elongationC = during terminationD = during protein release
If an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹
For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF 2 B. eIF4 C. eIF5
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal
Based on the electron micrograph shown, which of the following statements is/are correct/true? Select all that apply. You may select mutiple options. DNA and mRNAs are marked by arrows. DNA mRNAs #3 Left Right 1 μm You cannot determine relative mRNA lengths from this image You cannot determine the direction of transcription from this image the longest mRNA is on the right side ✔Direction of transcription is left to right O Direction of transcription is right to left the 5' end of the mRNA marked #3 is at the bottom O the longest mRNA is on the left side the 5' end of the mRNA marked #3 is at the top You cannot determine the 5' or 3' mRNA ends from this image
Prokaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery? What are the properties of RBS? Draw a simple scheme for RBS and mRNA interaction site.
A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. Initiation factor 3
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.
Although the genetic code is universal, a few organisms such as Paramecium have a slightly modified version in which UGA, a stop codon for most organisms, codes for tryptophan in Paramecium. Suppose that the researcher wanted to make an in vitro translation system using all of the components from Paramecium. Which of the components, if any, would she need to replace in order to have an in vitro system that was universal? Possible Answers: A. She would need to leave out the P site. B. She would need to leave out the termination factor proteins. C. She would need to leave out the tRNA that recognizes UGA. D. She would need to leave out the ubiquitin