FMet pro UAC GGG AUGCCCACG UAG MRNA

Q: During the termination of translation, what is the correct polypeptide sequence which will be…

A: DNA is the storehouse of genetic information. This information age expect by the formation of an…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: Explain the functional roles of the A, P, and E sites during translation.

A: In molecular biology, translation is a process in which ribosomes in the cytoplasm or endoplasmic…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Describe in detail the steps of translation termination in bacteria. Explain what happe

A: For the synthesis of a polypeptide with a defined sequence, two fundamental chemical requirements…

Q: Which of the following base sequences is used during transcription? a. Promoter and terminator b.…

A: Transcription is a template of DNA strand that is used in the profitable synthesis of messenger RNA…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Explain where the energy comes from for the peptide bond formation during translation

A: The translation is the biochemical process of the synthesis of the polypeptide chain of amino acid…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: During translation, amino acid chain termination requires

A: Translation is the biological process of converting the mRNA sequence to a sequence of amino acids.…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: A tRNA with an ACC anticodon will insert the amino acid ________ during translation. A.Trp B.Arg…

A: tRNA or transfer RNA helps in decoding the sequence of mRNA into protein. It is structured to bind…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: 5’      UUGCAUUGCAGC    3’    Write out ALL of the possible reading frames for the RNA shown in…

A: The DNA acts as the genetic material of a living organism. This DNA generally gets replicates to…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A:

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: List the three types of RNA directly involved in translation.

A: The translation is the biological process in which cells synthesize proteins. It occurs at the…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.

A: The givem template sequence is as follows,  TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: Which of the following are stages of translation?

A: The translation is the process of converting the information in mRNA to Proteins. Ribosome which has…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A:

Q: Which of the following is a function of the 7-methylguanosine cap? a. Exit of mRNA from the nucleus…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: translation

A:

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: Give the elongation factors used in bacterial translation and explain the role played by each factor…

A: Protein synthesis involves in three stages: initiation, elongation, and termination. Elongation is…

Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are…

A: The process of translation is initiated by the start codon which is a nucleotide triplet situated in…

Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…

A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires: a.tRNAfMet…

A: Translation is the process of synthesis of protein. In prokaryotes, it occurs in cytosol, large and…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: Energy that drives translation is provided mainly by______ . a. ATP c. GTP b. amino acids d. all of…

A: Translation is the process of protein synthesis using messenger RNA as a template.

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…

Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: Translation is the process by which the sets of 3 bases (codons) of the MRNA are read to specify the…

A: The translation is a process through which the mRNA gets translated into polypeptide chains. The…

Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…

A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: Translation a. In the diagram above, draw a rectangle around the part that represents translation.…

A: Need to answer the questions related to translation process.  Need to determine the step by step…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Q: Of the following, which is a modification made to the pre-mRNA of eukaryotes before translation?…

A: According to the central dogma the genetic information stored in the form of DNA is first converted…

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…