What is the order of the polypeptide chain shown in the images provided?    Starting at the beginning of translation, determine the order of the amino acids in the polypeptide chain shown in this figure. Choose correct amino acids from the drop-down menu. (The choices from drop down menu are below).   1. (Choices): Leucine, Valine, Methionine 2. Leucine, Valine, Glycine 3. Valine, Methionine, Leucine 4. Methionine, Leucine, Glycine

Q: GCA UGC CGA UAC

A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC

Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…

A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: What is the estimated speed of translation of human? Please give reasonable explaining and provide…

A: The translation is the process of protein synthesis which occurs in the ribosomes. It takes place…

Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…

A: Genes are the structural and functional units of heredity. They carry coded genetic information in…

Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…

A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Q: A glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If…

A: Single base substitutions in which change in only one base pair occurs.

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) Transcription- When…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…

A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…

A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…

Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…

A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…

A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…

A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…

Q: The following polynucleotide was synthesized and used as a template for peptide synthesis in a…

A: The DNA template is used to form an mRNA polynucleotide by the process of transcription. The mRNA…

Q: With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere…

A: A cell "reads" the information in a messenger RNA (mRNA) during translation and uses it to create a…

Q: Is N-formyl-methionine used to start translation in eukaryotes? Yes No

A: Translation is the process in which ribosomes synthesize proteins after the process of transcription…

Q: Which of the following amino acids is carried by the tRNA that initiates translation in eukaryotes?…

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: List all possible codons present in a ribonucleotide polymer containing U and G in random sequence.…

A: Molecular biology is the study of biology at a molecular level. It studies the composition,…

Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C  5 ’…

A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.

Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…

A: Note - We answer one question at a time. The set of rules through which information in the DNA or…

Q: A random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a…

A: Amino acids are coded by a tripeptide sequence called codons. The first two positions of the codon…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: A SNP that results in loss of all catalytic activity of a drug-metabolizing enzyme is most likely to…

A: snip is genetic variation which may leads to replace cytosine with thymine at the same places along…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…

A:

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…

A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…

Q: . The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis…

A: Polypeptide is made up of chain of amino acids linked together. Polypeptides  are connected together…

Q: Use the codon table to determine one possible DNA sequence that corresponds to the following amino…

A: A sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a specific amino…

Q: two differences and 2 similarities between prokaryotic and eukaryotic translation initiation

A:

Q: In studies using repeating copolymers, AC . . . incorporates threonine and histidine, and CAACAA . .…

A: A protein's amino acid sequence is determined by the sequence of nucleotides in DNA and RNA.  It is…

Q: A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,…

A: A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,…

Q: Why is it necessary for an in silico translation tool to provide 6 different frames of the…

A: The open reading frame or the ORF is the gene region that can get translated by the translational…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

A:

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…

Q: Of all of the different codons that exist, three of them ___.   do not specifiy a particular amino…

A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…

Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…

A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.