Identify the correct recognition site for ribosomal subunit binding during translation. the 30s subunit binds to the 7-methylguanosine cap at the 3’ end of eukaryotic mRNA the 60s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eubacterial mRNA the 40s subunit binds to the 7-methylguanosine cap at the 5’ end of eukaryotic mRNA the 70s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eukaryotic mRNA the 50s subunit binds to the 7-methylguanosine cap at the 3’ end of eubacterial mRNA

Identify the correct recognition site for ribosomal subunit binding during translation. the 30s subunit binds to the 7-methylguanosine cap at the 3’ end of eukaryotic mRNA the 60s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eubacterial mRNA the 40s subunit binds to the 7-methylguanosine cap at the 5’ end of eukaryotic mRNA the 70s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eukaryotic mRNA the 50s subunit binds to the 7-methylguanosine cap at the 3’ end of eubacterial mRNA

Name: Identify the correct recognition site for ribosomal subunit binding du
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Identify the correct recognition site for ribosomal subunit binding during translation.the 30s subunit binds to the 7-methylguanosine cap at the 3’ end of eukaryotic mRNAthe 60s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eubacter

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Identify the correct recognition site for ribosome subunit binding during transcription.A. the 40s subunit binds to the “Shine-Dalgarno” sequence in eukaryotesB. the 60s subunit binds to the 7-methylguanosine cap in eukaryotesC. the 30s subunit binds to the “Shine-Dalgarno” sequence in eubacteriaD. the 50s subunit binds to the 7-methylguanosine cap in eubacteriaE. the 70s subunit binds to the “Shine-Dalgarno” sequence in eubacteria
Many antibiotics are effective as drugs to fight off bacterial infections because they inhibit protein synthesis in bacterial cells. Using the information provided in the following table that highlights several antibiotics and their mode of action, discuss which phase of translation is inhibited: initiation, elongation, or termination. What other components of the translational machinery could be targeted to inhibit bacterial protein synthesis? Antibiotic Action 1. Streptomycin Binds to 30S ribosomal subunit 2. Chloramphenicol Inhibits peptidyl transferase of 70S ribosome 3. Tetracycline Inhibits binding of charged tRNA to the A site of the ribosome 4. Erythromycin Binds to free 50S particle and prevents formation of 70S ribosome 5. Kasugamycin Inhibits binding of tRNAfMet 6. Thiostrepton Prevents translocation by inhibiting EF-G
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
Find the events from prokaryotic translation from the list below and list them below in order, by letter, from earliest to latest during translation A. Incoming tRNA occupies the A-site B. Small ribosome binds to Shine Dalgarno sequence C. 5’ methyl cap binds small ribosome D. Large ribosome subunit binds the small ribosome subunit E. P-site tRNA peptide is attached to the amino acid of the A-site tRNA. F. f-Met tRNA binds to P site G. Small ribosomal subunit binds mRNA H. Peptide released from complex.
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
some eukaryotic mRNAs have internal ribosome binding sites, where ribosomes can bind without first attaching to the 5′ cap. Yet all eukaryotic mRNAs are capped, and cap-dependent translation is highly efficient. What might be the advantage of having internal ribosome binding sites if the cap permits the initiation of translation and all eukaryotic mRNAs are capped?
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAi fMet
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Which of the following statements about translation is false? In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. Peptidyl-transferase activity during translation is the property of a ribozyme. A base at the first position of an anticodon on the tRNA would pair with a base at the third position of the mRNA. The growing peptide chain is transferred from the tRNA in the P site to the tRNA in the A site. Ribosomes move along an mRNA in the 3’ → 5' direction.
A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. ATP
Put the following events of elongation in prokaryotic translation in chronological order. 1. Binding of mRNA with small ribosomal subunit 2. Recognition of initiation codon 3. Complementary base pairing between initiator codon and anticodon of initiator tRNA 4. Base pairing of the mRNA codon following the initiator codon with its complementary tRNA 5. Attachment of the large subunit 2, 1, 4, 3, 5 5, 4, 3, 2, 1 1, 2, 3, 5, 4 1, 2, 3, 4, 5