You want to maintain pH-7.0 for an enzyme-catalyzed reaction that will produce hydrogen ions along with the desired product. At equal concentrations, which weak acid, if any, will serve as the better buffer for the reaction: acid A, with pk-6.5, or acid B, with pk-7.5?
Q: In the following polypeptide, which amino acid would be participating in hydrogen bonding with…
A: Alpha helix is one of the most prominent secondary structures formed by polypeptide chains. The…
Q: Formation of cholesterol "fund" in the liver.
A: Cholesterol contains 27 carbon atoms all supplied by acetyl CoA. Cholesterol has 3 six-membered…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: 1.2 Ninhydrin Test Substance 2% glycine 2% gelatin 2% albumin 1% tyrosine casein + distilled water…
A: Ninhydrin test : It is the alpha-amino groups in proteins and amino acids that are responsible for…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: The number of calories used during physical exercise is greater than the number of calories used for…
A: Since you have posted multiple questions, we will provide the solutiononly to the first three…
Q: Name : Surname: 2. The amino acid side chain residues in an a helix point center of the helix. A)…
A: The proteins consist of 20 naturally occurring amino acids. The proteins must fold into the proper…
Q: A) Polymer Lipid DNA B) Monomer (or component units in the case of lipids). Draw the specific…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: a) Draw the 5’-monophosphate-2’-deoxyguanosine nucleotide covalently bonded with neighboring DNA…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: 1. Answer the following questions: a. A substance produced from pyruvate that is a precursor in the…
A: Glucose is the simplest carbohydrate, which is utilized as the primary source of energy. The complex…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: Transcription is the process of conversion of DNA to RNA, in this process the template strand is…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: Mechanism of cholesterol excretion from the body
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: In the lactase enzyme simulation you conducted in Part 1 of this Nutrition Lab, you found that…
A: The following steps will explain how lactase acts on a mixture of coffee and milk in comparison to…
Q: What does it mean for an amino acid to be polar? Please explain what qualities about an amino acid…
A: Proteins are folded polypeptides. A polypeptide is a polymer of amino acid residues linked via a…
Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…
A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…
Q: 13. Fill in the blanks using the keywords. +2 NADH +NAD+2 2 coenzyme A MITOCHONDRIA + CO₂ Glycolysis…
A: Introduction Glycolysis is a first step of cellular respiration. Glycolysis consists of 10 steps. In…
Q: You take out a 35-year mortgage loan for $634000. The annual interest rate of the loan that you pay…
A: To calculate the number of payments required to pay off a loan, you need to use the formula: n =…
Q: DNA MELTING Two antiparallel single strands form a DNA duplex according to the following model: SA…
A: Gibbs's free energy, also known as free energy or G, is a thermodynamic quantity that represents the…
Q: You want to digest 1 µg of plasmid DNA in a final volume of 50 µL. Your solution containing plasmid…
A: A plasmid is an extrachromosomal DNA molecule within a cell that is distinct from chromosomal DNA…
Q: Consider the amino acid aspartic acid for this problem. Aspartic acid can be considered a triprotic…
A: Aspartic acid have 3 ionizable groups in it. They are; alpha- carboxyl group alpha-amino group…
Q: What are the two monosaccharides that make up this structure? H₂N НО CH3 OH OH H NH₂ N
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…
Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…
A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: True and false - A k+ channel will be just as permeable to Na+ as to K+ because Na+ is a smaller ion…
A: Ion channels are proteins that form pores in the plasma membrane and allow ions to pass through in…
Q: Fill in the blank 1.) triaycerols form_____ rather than lipid bolsters 2.) the most abundant…
A: Triacylglycerols are fatty acid esters of glycerols, with 3 fatty acids (long hydrocarbon chain…
Q: Long chains of beta glucose monomers are held together in microfibril bundles by bonds Vanderwaals…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Answer 2 The Bose-Einstein Principle -Bose-Einstein condensate is a group of atoms cooled to within…
Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…
A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…
Q: Which pathways are utilized in order to allow for glucose from glycogen to be converted to ribose…
A: Glycogen is a storage polysaccharide made up of D-glucose residues. When signalled, the cell can…
Q: 5. Ways of cholesterol biotransformation, their tissue localization: 5.1. extracellular (LCAT) and…
A: Sterols are lipids with the characteristic steroid nucleus. The steroid nucleus is four fused rings,…
Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Consider a hypothetical metabolic pathway involving four enzymes to convert molecule A into molecule…
A: Allosteric enzymes are enzymes whose catalytic activity is regulated by an effector molecule that…
Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…
A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…
Q: Draw two ringed a-D glucose monomers forming a disaccharide (maltose). Make sure to label the…
A: Glucose is a 6 carbon containing aldose sugar i.e. it is an aldohexose. The most stable ring form of…
Q: A 24-residue peptide called Pandinin 2, isolated from scorpion venom, was found to have both…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 2. A mutation that changes an alanine residue in the interior of a protein to valine (A157 → V157)…
A: Different protein gain its three dimensional structure after folding, which occurs according to the…
Q: Bond Type: Description: ОН CH2OH ОН ОН ОН Н ОН От CH₂OH ОН Н OH-0 ОН Н ОН :CI: Nat :ci: Nat Na :CI:…
A: Chemical bonds are formed between the same or different atoms to give rise to chemical compounds.…
Q: argarines made from plants oils are healthier ,since they are hydrogenated. A) TRUE B)FALSE
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: Why does the lack of carnitine causes hypoglycemia, muscle weakness? Justify the answer…
A: INTRODUCTION : Hypoglycemia : It is a disorder or condition in which the levels of the body's blood…
Q: 1.a)Which statement is correct with respect to eggs? The white of an egg has about equal quantities…
A: Proteins are complex macromolecules that play a central role in the structure and function of all…
Q: 1. 2. NaBr 3. H₂O₂ 4. Al₂(MoO4)3 5. AgNO3 Fe₂(SO4)3
A: In one molecule of a compound how many numbers of atoms of each element are present is…
Q: Consider the reaction below. Where would the labelled carbon (represented by the asterisk * in the…
A: As you can see the reactant side is undergoing the reaction where there is removal of CO2 and NADP+…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: Circle the functional groups on the R-group of the AMINO ACIDS below that are capable of forming…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 1. In Clinical Chemistry, are enzymatic methods for determining glucose, cholesterol, and uric acid more preferred than non-enzymatic methods?Which of the following statements about the allosteric site is true? a. The allosteric site is a second active site on a substrate in a metabolic pathway. b. The allosteric site on an enzyme can allow the product of a metabolic pathway to inhibit that enzyme and stop the pathway. c. When the allosteric site of an enzyme is occupied, the reaction is irreversible and the enzyme cannot react again. d. An allosteric activator prevents binding at the active site. e. An enzyme that possesses allosteric sites does not possess an active site.In an enzymatic reaction: a. the enzyme leaves the reaction chemically unchanged. b. if the enzyme molecules approach maximal rate, and the substrate is continually increased, the rate of the reaction does not reach saturation. c. in the stomach, enzymes would have an optimal activity at a neutral pH. d. increasing temperature above the optimal value slows the reaction rate. e. the least important level of organization for an enzyme is its tertiary structure.
- 1. Consider the following parameters related to an enzyme that follows Michaelis-Menten kinetics for the reaction: k(1) k(2) S ----> ES ----> P k(-1)Given a tripeptide Cys-His-Lys, Cys: Pk1 = 1.5; Pk2 = 10.8; PkR = 8.5 His: Pk1 = 1.6; Pk2 = 9.0; PkR = 7.0 Lys: Pk1 = 2.2; Pk2 = 8.5; PkR = 9.8 a.draw the protonic equilibria for the tripeptide. b.what is the IpH? c.What is the dominant structure at pH 3.0? d.What is the first buffering region of the tripeptide?Using Figure 1.3 of the Introduction as an example, a) draw all the structures of the tribasic amino acid lysine involved in the equilibrium reactions that would take place during titration against NaOH, starting with the fully protonated form below (draw the R-group in full). HAN+-CH- COOH (CH2)4 NH°+ b) indicate the numerical pa value of each equilibrium reaction, and which ionizable group is being dissociated in each step. c) indicate the net charge of the amino acid at each step and identify the zwitterion. d) Calculate the pI of this amino acid (show the calculation). e) What would be the predominant ionization states of this amino acid at physiological pH (7.4) and at this pH, what would the ratio of these two states be (show the calculation)?
- 1. Can you describe how electrostatic and steric considerations may lead to preferential stabilization of the transition state at an enzyme active site? 2. What factors are involved in “transition-state complementarity”?1.A student was given two test tubes. One tube contains a reaction catalyzed by an inorganic catalyst, while the second tube contains a reaction catalyzed by an enzyme which is protein in nature. Give two laboratory procedures which you can perform to differentiate which of the two tubes contain an enzyme-catalyzed reaction. 2. List the enzymes whose levels are elevated in blood serum as a result of hepatitis or cirrhosis of the liver.19. Define the terms “cofactor” and “coenzyme.” 20. What is the difference between general acid-base catalysis and specific acid-base catalysis? (Assume that the solvent is water.)
- You have an initial solution in which you added quantities of “A” and “B” such that there is 4.5 M “A” and 2.5 M “B” and no complex (“AB”) at time 0. After equilibrium, you are able to isolate and quantitate the “AB” complex, and find its concentration is 1.5 M. Given that RT is 0.59 kcal/mol, what is the delta Go’ for the association reaction?5. a) Why would an enzyme that is effective with one reaction have no effect on another reaction?6) What is the approximate temperature (in both F° and C°) for enzyme activity in the human body?