7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and of water for a final volume of mL. Question # 7 mL of stock mL mL of water mL mL final volume mL
Q: 7. All amino acids have a chiral a-carbon EXCEPT A) Proline B) Alanine C) Glycine D) Tryptophan 8.…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: Which of the statement/s is TRUE of electrolytes? I. They are positively and negatively charged…
A: Electrolytes are substances present in the blood and carry an electric charge. Osmosis is the…
Q: 1in oxidative phosphorylation, what is oxidized and what is phosphorylated? 2 name three types of…
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation.…
Q: In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene…
A: Molecular weight of the protein can be calculated by adding the molecular weight of the individual…
Q: Question 24 Which of the following is not a cell surface receptor? GPCR DNA-associated receptor RTK…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: he initial velocity data shown in the table were obtained for an enzyme. Each assay at the…
A: Michaelis-Menten described the relationship between reaction velocity and substrate concentration.…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: Which of the conditions would result in the greatest amount of transcription of the lac operon? I.…
A: Gene expression essentially involves the production of the polypeptide chain that a certain gene has…
Q: The number of calories used during physical exercise is greater than the number of calories used for…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: Question 20 Signal sequences are often found at the C-terminus of the polypeptide chain. True ●…
A: Proteins are polypeptide chains that are made up of amino acids. They are synthesised during…
Q: You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be…
A: Beers law states that the absorbance of a sample depends on the amount of sample present and path…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: What are the health benefits of squash in a dessert recipe?
A: Squash is a comforting, delicious, and nutritious meal that is a mainstay throughout the autumn…
Q: The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn…
A: Proteins are polymers of amino acid residues linked via peptide bonds. Amino acids are biomolecules…
Q: Draw a two-stranded anti-parallel beta-sheet where each strand is 5 amino acids long. Use “R” to…
A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets. The alpha…
Q: The lens of the eye si the light refracting medium of the eye, and ti has no mitochondria. Glucose…
A: "Since you have posted a question with multiple sub parts, we will provide the…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: QUESTION 03 - Regarding the amino acid arginine, answer the following questions: (Data: pka NH₂ Lyd…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Which of the following does NOT correctly describe the fluid mosaic model of lipid bilayer? A.…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…
A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…
Q: A drug with an elimination half-life of 1 hour was given to a male patient weighing 60 g by IV at…
A: Given, Rate of administration IV (R) is 300 mg/hr Plasma drug concentration at 7 hours was (C) 11…
Q: Which method of chromatography would be the most appropriate for separating mixtures of the…
A: Chromatography is a technique used to separate molecules based on their Solubility in mobile and…
Q: What charge does a protein molecule have? O neutral O positive O negative O The charge depends on…
A: Diffusion and osmosis are 2 processes that depict the movement of substances from higher…
Q: Calculate hematocrit for Susie's whole blood sample, given the following information: RBC volume =…
A: Introduction Whole blood is composed of erythrocytes (RBC), platelets and leukocytes (WBC). The…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: Before myristic acid (14:0) can be oxidized to carbon dioxide and water, it must first:
A: Fatty acid catabolism involves beta oxidation followed by metabolism of the Acetyl CoA molecules…
Q: Coenzyme Q (ubiquinone) can transport electrons between: OA) Complex I and Complex II. OB) Complex…
A: Coenzyme Q also known as Ubiquinone is a mobile electron carrier of the Electron Transport Chain…
Q: Cystic fibrosis is a recessive disease that affects many parts of the body, but primarily presents…
A: The CFTR gene codes for the protein cystic fibrosis transmembrane conductance regulator (CFTR). The…
Q: Give one example of a disease related to heart and briefly explain the molecular basis of the…
A: The human body, just like any other complex lifeform (or even simple lifeforms ) functions as a…
Q: Question 25 Proteins synthesized on free ribosomes are transported to which cellular destination? O…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Some enzymes are used in the clinical lab to diagnose diseases. There are two specific markers for…
A: Lactate dehydrogenase (LDH) catalyses the following reaction: Lactate + NAD+ ↔ Pyruvate + NADH + H+…
Q: The folding of an unfolded protein proceeds from low entropy disordered state to a single high…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Give other chromatographic techniques that can be used for separating non-polar biomolecules, such…
A: Introduction: Chromatography is a method for separating a mixture in the laboratory. The mixture is…
Q: Mercury poisoning would affect which of the following? OA) Pyruvate dehydrogenase complex. B)…
A: Mercury poisoning is a disease caused by exposure to mercury or its toxic compounds. Mercury is a…
Q: Adipose triglyceride lipase (ATGL) hydrolyzes a fatty acyl group from: A) monoacylglycerol. B)…
A: ATGL is adipose triglyceride lipase is an enzyme of lipolysis. It helps in hydrolysing the fatty…
Q: Consider a defect in MIG12 that prevents the binding of this protein to acetyl-CoA carboxylase. How…
A: Introduction: Acetyl carboxylase is a multifunctional enzyme that contains three functional domains…
Q: Metabolism processes that generate fadh2 are select all that apply beta oxidation…
A: FAD is a derivative of the vitamin B2 or Riboflavin. It acts as coenzyme in most of the oxidation…
Q: Which of the following fat-soluble vitamins would test positive for the Baeyer's test? Stapanan…
A: Baeyers test is a test for unsaturation. Baeyers reagent consists of cold alkaline KMnO4. It gives…
Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…
A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…
Q: For the study of alanine production by a recombinant strain of E. coli, cultivation was carried out…
A: A recombinant strain is a type of genetically modified organism (GMO) that has been artificially…
Q: How are soaps made? Draw the full saponification reaction between potassium hydroxide and a…
A: Lipids are one of the 4 biomacromolecules. Majority fraction of a lipid molecule would be…
Q: Dihydrofolate reductase is used twice for the reduction of folate to tetrahydrofolate. 2.…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Sometimes enzymes…
Q: Some types of tumors express cell-surface receptors that are specific for unique peptide sequences.…
A: Of these 9 amino acids, 7 amino acids(H,W,S,Y,L,P,G) will be carrying a positive charge at pH 4. At…
Q: hich of the following statements concerning uncompetitive inhibitors is true? a. They decrease the…
A: Uncompetitive inhibition is also known as anti-competitive inhibition, takes place when an enzyme…
Q: What is the function of uncoupling proteins in hibernating mammals? ○ A) They allow protons…
A: Uncoupling protein 1 or UCP1 (thermogenin) and is important in helping animals keep warm during the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Amino acids are needed to ________. build new proteins seive as fat stores supply energy for the cell create red blood cellsGive at least 5 sources of protein.Which of the following is not a function of a protein? help fight diseases build tissues such as bone and muscle control the rate of reactions and regulate cell processes store and transmit genetic information
- Identify three functions of body proteins and explain the roles that protein play in these functions.I’m stu k in both question please Q 1. To make 500 mL of 1x Buffer, measure ANSWER mL of 10x stock and add ANSWER mL water to make the total volume ANSWER mL. This is a 1: ANSWER Dilution. Q2 You have a 1 g/mL stock solution of protein. To make 100mL of 200 mg/mL solution, add ANSWER mL of stock and ANSWER mL of water for a final volume of ANSWER mL. (HINT: Convert units)The function of a protein depends on the protein's ______ A. size B. structureC. pH
- List six functions of proteins in the body.Many people relate protein to health and fitness. How much protein do we really need? What is the role of protein and exercise? What are your thoughts regarding protein supplements, shakes, and protein bars?Do we able to make all proteins in our body? Explain your answer.
- 4. Which of the following is the CORRECT pair of a protein and its function? * A. Hemoglobin: helps regulate blood sugar levels B. Actin and myosin: supplies amino acids to baby mammals C. Rhodopsin: provides strength and flexibility to connective tissues D. Enzymes: speed up reactions in the body and eventually used up in the processDescribe the four levels of protein structure that a person can go through to reach its functional form.Which of the following can control or slow down protein mobility? I. cholesterol II. cytoskeletal systems III. protein size and viscosity IV. other proteins I, II, III only II, III, IV only I, III, IV only I, II, III, IV