Concept explainers
Not all proteins are made from the RNA genome of bacteriophage MS2 in the same amounts. Can you explain why? One of the proteins functions very much like a repressor, but it functions at the translational level. Which protein is it and how does it function?
The RNA bacteriophage are very small, around 25 nm in diameter with icosahedral virion structure. For example, MS2 (having positive strand RNA) virus has a small genome, which encodes only four types of proteins. These are 1) Mutation proteins, which are present as a single copy in a mature virion, 2) coat protein, 3) lysis protein and 4) subunit of RNA replicase (it is the enzyme, which replicates the viral RNA). RNA replicase protein consists of one virus encoded polypeptide and many peptides of the host.
Explanation of Solution
The RNA of phage MS2 is folded in a complicated way, thereby, leading to formation of an extensive secondary structure. The translation at coat protein site on m-RNA starts very early upon viral infection, as it is most accessible to translation machinery among the four AUG translation sites. The m-RNA replicase enzyme also translate early. Since coat proteins translate early, they start increasing in number in number within the cell. Coat proteins start binding to RNA at AUG region, which is the initiation site for replicase protein and shit down the production of replicase. Therefore, coat protein also acts like a repressor protein. Also due to extensive folding of RNA limited copies maturation protein is produced even though it is present at 5’ end. Thus translation regulation occurs due to the folding of RNA, thereby, producing limited proteins for viral assemble. Coat protein, however is required in large quantity, therefore it is majorly produced.
Want to see more full solutions like this?
Chapter 10 Solutions
Mastering Microbiology with Pearson eText -- Standalone Access Card -- for Brock Biology of Microorganisms (15th Edition)
- If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardSome of the mutations of the type mentioned in Problem 28 have an interesting property: they prevent the formation of the antiterminator that normally takes place when the tryptophan level is low. In one of these mutations, the AUG start codon for translation of the 5′ UTR has been deleted. How might this mutation prevent antitermination from taking place?arrow_forwardWhy is it advantageous to have a mechanism to override the effect of stop codons in protein synthesis?arrow_forward
- A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a tRNA that recognizes the codon GAA, and is charged with the amino acid glutamic acid (Glu). The mutant tRNA is still charged with Glu, but it recognizes the codon UAA. What effect will this have on translation in these cells? How will the proteins produced be different? Speculate: is this mutation more likely to be beneficial or harmful?arrow_forwardA codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense mutation. In accord with the genetic code given in Figure 15.10, is this mutation a transition or a transversion? At which position of the codon does the mutation occur?arrow_forwardThe first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is GUG, which codes for valine. Why isn’t the first amino acid formylmethionine or valine?arrow_forward
- The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. Even so, the riboswitch in B. subtilis regulates transcription, whereas the one in E. coli regulates translation. What is the role of the 5′ region in both riboswitches? How can one riboswitch regulate transcription while the other regulates translation?arrow_forwardWhich of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′arrow_forwardA certain gene in a bacterium codes for a polypeptide that is 400 amino acids long. How many nucleotides are needed in the mRNA to code for this polypeptide?arrow_forward
- You find that a diploid specimen in the lab has a mutation in a tRNA gene on one of its chromosomes. The anticodon of this variant tRNA has changed from 5’ UUC 3’ to 5’ UUA 3’, but can still be charged with its typical amino acid. What amino acid is normallybound to this tRNA and what predicted effect would it have on protein translation? Be specific.arrow_forwardBacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated in places where the mRNA folds back on itself to form a hairpin-looped structure like the one shown below. How do you think that this structure stops transcription?arrow_forwardVaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs in the eukaryotic cells it infects. Besides allowing degradation of the host’s mRNA, what step in translation of the host’s mRNAs does this prevent? Group of answer choices Movement of tRNA from the A site to the P site tRNA binding to the A site Recognition of the stop codon Ribosome small subunit from binding mRNA Movement of the tRNA from the P site to the A sitearrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning