![EBK BIOLOGY](https://www.bartleby.com/isbn_cover_images/8220106777640/8220106777640_largeCoverImage.jpg)
EBK BIOLOGY
6th Edition
ISBN: 8220106777640
Author: Maier
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 8LTB
Summary Introduction
Introduction:
The process of converting RNA into proteins is termed as translation. It occurs after transcription. The mRNA formed by the process of transcription undergoes translation to synthesize proteins. tRNA is an important component in the process of translation.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Suppose the codon sequence
GUGCAAUUCGAGGCC
has a single base pair mutation to
GUGCAAUUCAAGGCC.
If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene?
____________________________.
An amino acid is added to the CCA terminus of the tRNA molecule.
true or false
Some aminoacyl-tRNA molecules bind to more than one codon because there is some play or wobble in the ____________ of the codon.
Question 18 options:
first base
second base
third base
first and third bases
none of the above
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAarrow_forward_____________ are molecular machines that excise introns from pre-mRNA and then join exons together.arrow_forwardWhat is meant by the degeneracy of the genetic codearrow_forward
- The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is this beneficial when it comes to errors in DNA replication or transcription?arrow_forwardThis question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else, so that Moodle can grade your question correctly.arrow_forwardSPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C A T T A T C T A G Aarrow_forward
- Select the antisense strand of the DNA (opening at 3’ end from the left) and have it transcribed (RNA codons for translation). Translate the RNA codons using the given genetic code.arrow_forwardA _____________________ is a purine-rich sequence closeto AUG (the initiation codon) on a prokaryotic mRNA thatbinds to a complementary sequence on the 30S ribosomesubunits, thereby promoting the formation of the correctpreinitiation complex.arrow_forwardA _____________ is a purine-rich sequence in close proximity to AUG on a prokaryotic mRNA that binds to a complementary sequence on the 30S ribosome subunits, thereby promoting the formation of the correct preinitiation complex.arrow_forward
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterarrow_forwardWhen examining the genetic code, it is apparent that ________. there are 44 stop codons because there are only 20 amino acids there can be more than one codon for a particular amino acid AUG is a terminating codon the code is ambiguous in that the same codon can code for two or more amino acids there can be more than one amino acid for a particular codonarrow_forwardA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY