Starting Out with C++ from Control Structures to Objects (9th Edition)
9th Edition
ISBN: 9780134498379
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 9PC
Program Plan Intro
Most Frequent Character
- Include the required header files to the program.
- Declare function prototype which is used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input C-string from the user and call the function “frequent_char” with the input C-string.
- Check the input has a frequent character.
- Print the result.
- Define the “frequent_char” function.
- Declare the required variable.
- Get the length of the string and set that length to array variable.
- Initially set all element of that array to 0.
- Calculate the frequencies of the character in that string.
- Finally return the result to the main function.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Computer Science
****Please Write a program CODE in C
2. Write a function which takes a string of any length and returns the number of times the
letter a appears in the string.
Write the main program, which prompts the user to enter a sentence (up to 100
characters) and uses the function to find the number of times a occurs in the sentence.
Print the result.
Create a function called reverse() that has a string parameter. The function reverses the characters of the string locally. ( in C language)
C++
Write an expression to access the last character of a string class object str
(not C-string)
Chapter 10 Solutions
Starting Out with C++ from Control Structures to Objects (9th Edition)
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Write a statement that will convert the integer...Ch. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 17PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- 4. Complete the function show_upper. This function takes one parameter - a string (s). It should return a string made up of all the upper-case characters in s. For example, if s is “aBdDEfgHijK” then show_upper should return “BDEHK”. It should return the upper-case string - not print it. Do not change anything outside show_upper.arrow_forwardString Manipulation In this question, you will be implementing the following functions int findChar(char * str, char c); Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1 int replaceChar(char * str, char c1, char c2); Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0. int removeChar(char * str1, char * str2, char c); Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’ For example, if str1=”Hello World” and c=’l’ then the function should make str2=”He**o Wor*d” int isPalindrome(char * str) Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc. int reverseString(char…arrow_forwardExercise 1: Word Separator Write a program that accepts as input a sentence in which all of the words are run together, but the first character of each word is uppercase. Convert the sentence to a string in which the words are separated by spaces and only the first word starts with an uppercase letter. For example the string StopAndSmellTheRoses. would be converted to “Stop and smell the roses.” Exercise 2: replaceSubstring Function Write a function named replaceSubstring. The function should accept three string object arguments. Let’s call them string1, string2, and string3. It should search string1 for all occurrences of string2. When it finds an occurrence of string2, it should replace it with string3. For example, suppose the three arguments have the following values: string1: “the dog jumped over the fence” string2: “the” string3: “that” With these three arguments, the function would return a string object with the value “that dog jumped over that fence.” Demonstrate the…arrow_forward
- python3 program : Write a function that removes all spaces from a given string string and returns the new string.arrow_forwardPython language. Write a function that return multiple value of string type. You have to print those in main function. Hint : - you can use dictionaryarrow_forwardB4- Declare a string variable in Python with any three words as its value. Describe three functions to change the case of the words stored in the variable with examples.arrow_forward
- Write a function that takes a reference to a string as an argument and which converts the string to all uppercase.arrow_forwardQuestion Mo Write a function that accepts a pointer to a C-string as its argument. The function should count the number of times the character ‘G’ or the character ‘H’ occurs in the argument and return that number. Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this linearrow_forwardComplete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" use python please def check_character(word, index): # Type your code here. if __name__ == '__main__': print(check_character('happy birthday', 2)) print(check_character('happy birthday', 5)) print(check_character('happy birthday 2 you', 15))…arrow_forward
- C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forwardC++ Code Please Write a program that prompts the user to input a string. The program then uses the function substr to remove all the vowels from the string. For example, if str = "There", then after removing all the vowels, str = "Thr". After removing all the vowels, output the string. Your program must contain a function to remove all the vowels and a function to determine whether a character is a vowel.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning