Concept explainers
(a)
Interpretation:
The stronger base from given pair should be identified.
Concept introduction:
Strong Acids: Acids that dissociates into ions completely which results in easy donation of protons are considered as strong acids. Strong acid forms weaker conjugated base.
Weak Acids: Acids that do not easily dissociate into ions completely which has difficulty in proton donation are considered as weak acids. Weak acid forms stronger conjugated base
Strong Base: Bases that has strong attraction towards protons and accepts readily. Strong base forms weaker conjugated acid.
Weak Base: Bases that has little affinity towards protons. Weak base forms stronger conjugated acid.
If a base receives one proton, then the formed species is a conjugate acid whereas an acid lose one proton, then the formed species is a conjugated base.
(b)
Interpretation:
The stronger base from given pair should be identified.
Concept introduction:
Strong Acids: Acids that dissociates into ions completely which results in easy donation of protons are considered as strong acids. Strong acid forms weaker conjugated base.
Weak Acids: Acids that do not easily dissociate into ions completely which has difficulty in proton donation are considered as weak acids. Weak acid forms stronger conjugated base
Strong Base: Bases that has strong attraction towards protons and accepts readily. Strong base forms weaker conjugated acid.
Weak Base: Bases that has little affinity towards protons. Weak base forms stronger conjugated acid.
If a base receives one proton, then the formed species is a conjugate acid whereas an acid lose one proton, then the formed species is a conjugated base.
Want to see the full answer?
Check out a sample textbook solutionChapter 10 Solutions
Fundamentals of General, Organic and Biological Chemistry Volume 1, 5th custom edition for Spokane Community College
- if glutamic acid were replaced by proline in a protein, how would the tertiary structure be affected?arrow_forwardWhat is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’arrow_forwardIdentify the following nucleic acid bases and then classify whether it is a purine or pyrimidine.arrow_forward
- Identify the conjugate acid-base pairs in the following reactions: HNO2(aq) + H2O(l) → NO2 – (aq) + H3O+(aq) _______ ______ _________ ________ CH3NH2 + H2O(l) → CH3NH3+ + OH – _______ ________ ________ _________arrow_forwardFollowing are two structural formulas for (S)-serine, one of the building blocks of proteins Is (S)-serine better represented by structural formula A or B?arrow_forwardDraw the structure of the tripeptide alanylglycylvaline and determine its name using three-letter abbreviations.arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning