Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |
Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
BIOLOGY:ESSENTIALS (LL)-W/CONNECT
- A DNA fingerprint is based on _____. a repeating sequences found on noncoding regions b the presence of restriction enzymes c a single repeating region d repeating sequences found on coding regionsarrow_forwardIf a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how many fragments will beproduced when the enzyme is digested with DNA with the followingsequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGCa. Two c. Fourb. Three d. Fivearrow_forwardChoose the one answer that fits best. Which statement regarding Molecular Biology is NOT correct (videos)? a. Taq Polymerase was isolated from an organism found in Yellowstone Park b. Restriction enzymes leave sticky ends c. DNA sequencing allows us to read DNA sequences d. Restriction enzymes cut DNA at specific sites e. EcoRI and HindII are commonly used polymerasesarrow_forward
- The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many cuts were performed on DNA sequence A? A.) 2 B.) 3 C.) 4arrow_forwardThe following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many fragments were PRODUCED in DNA sequence A? A.) 2 B.) 3 C.) 4arrow_forwardWhich type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertionarrow_forward
- If you knew the sequence of a gene in one organism, how could you determine if another organism had a similar gene? A. insert the known gene into a vector and use the vector to insert the known gene into the other organism B. treat the genomes of both organisms with the same restriction enzyme and compare the patterns of the bands produced with gel electrophoresis C. create a hybrid of the two organisms by breeding them and check for mutations D. create labeled DNA probes from the known gene and use them to search the genome of the other organismarrow_forwardDNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis. Which fragment will migrate farthest in the gel? a. The 2000-bp fragment b. The 1000-bp fragment c. The 500-bp fragment d. All will migrate equal distances.arrow_forwardFrom where do we get primers for sequencing DNA? A) they are synthesized by reverse transcriptase B) they are cut out of plasmids using restriction endonucleases C) DNA primase is added to the sequencing reaction and synthesizes the primers D) biotechnology companies synthesize them using organic chemistryarrow_forward
- What is the enzymatic function of restriction enzymes? Group of answer choices a. to cut nucleic acids at specific sites b. to join nucleotides during transcription c. to add new nucleotides to the growing strand of DNA d. to repair breaks in sugar - phosphate backbonesarrow_forwardUsing the data in Table, identify restriction enzymes that (a) produce blunt ends; (b) recognize and cleave the same sequence (called isoschizomers); (c) produce identical sticky ends.arrow_forwardExplain how electrophoresis separates DNA strands. a. How is a DNA fingerprinting test interpreted? b. Define plasmid and how plasmids can change a bacteria’s activity. c. How do we digest/cleave plasmids? Explain the role of a restriction enzyme. d. Define sticky end and blunt end and which one is useful in molecular biology.arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College