Starting Out With C++: Early Objects, Student Value Edition & Myprogramminglab With Pearson Etext -- Standalone Access Card Package, 9/e
1st Edition
ISBN: 9780134645568
Author: GADDIS
Publisher: Pearson Education
expand_more
expand_more
format_list_bulleted
Expert Solution & Answer
Chapter 12, Problem 13RQE
Program Description Answer
To compare two strings, the function “strcmp” is used.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Question Mo
Write a function that accepts a pointer to a C-string as its argument. The function should count the number of times the character ‘G’ or the character ‘H’ occurs in the argument and return that number.
Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this line
Computer Science
****Please Write a program CODE in C
2. Write a function which takes a string of any length and returns the number of times the
letter a appears in the string.
Write the main program, which prompts the user to enter a sentence (up to 100
characters) and uses the function to find the number of times a occurs in the sentence.
Print the result.
Homework 10-2
Programming Challenge: 12 - Password Verifier
Use the string data type. Do not use arrays of type char or any functions in the old "C String" libraries.
Six characters? Seriously? Set the minimum password length to twelve characters.
We will also require that the password not contain any space characters.
In addition to the requirement that the password contain at least one upper case letter, one lower case letter, and one digit, add the additional requirement that the password contain at least one "special" character. We will consider any character that is printable, not alphanumeric, and not a space character to be "special." That includes punctuation, but may include additional non-punctuation characters. Unfortunately at our level of C++ it's more or less impossible for us to actually test passwords like Señor_99 but the ñ (with a tilde) would count as a special character using our rules.
Write functions to complete these tasks as appropriate.
Chapter 12 Solutions
Starting Out With C++: Early Objects, Student Value Edition & Myprogramminglab With Pearson Etext -- Standalone Access Card Package, 9/e
Ch. 12.2 - Write a short description of each of the following...Ch. 12.2 - What will the following program segment display?...Ch. 12.2 - Prob. 12.3CPCh. 12.2 - Prob. 12.4CPCh. 12.2 - Write code that uses the cin.get1ine function read...Ch. 12.2 - Indicate whether the following strcmp function...Ch. 12.2 - Prob. 12.7CPCh. 12.3 - Write a short description of each of the following...Ch. 12.3 - Write a statement that will convert the C-string...Ch. 12.3 - Prob. 12.10CP
Ch. 12.3 - Prob. 12.11CPCh. 12.3 - Prob. 12.12CPCh. 12.4 - What is the output of the following program?...Ch. 12 - A(n)___________is represented in memory as an...Ch. 12 - The____________ statement is required before the...Ch. 12 - A(n)____________is written in your program as a...Ch. 12 - Prob. 4RQECh. 12 - The______________ is used to mark the end of a...Ch. 12 - Prob. 6RQECh. 12 - Prob. 7RQECh. 12 - Prob. 8RQECh. 12 - Prob. 9RQECh. 12 - Prob. 10RQECh. 12 - Prob. 11RQECh. 12 - Prob. 12RQECh. 12 - Prob. 13RQECh. 12 - Prob. 14RQECh. 12 - Prob. 15RQECh. 12 - Prob. 16RQECh. 12 - Prob. 17RQECh. 12 - Prob. 18RQECh. 12 - Write a function whose prototype is char...Ch. 12 - #inc1ude iostream using namespace std; int main()...Ch. 12 - #include iostream using namespace std; int main()...Ch. 12 - #include iostream using namespace std; int main()...Ch. 12 - #inc1ude iostream #inc1ude string using namespace...Ch. 12 - #inc1ude iostream #inc1ude cstring using namespace...Ch. 12 - #inc1ude iostream using namespace std; int main()...Ch. 12 - #inc1ude iostream #inc1ude string using namespace...Ch. 12 - #include iostream #inc1ude cstring using namespace...Ch. 12 - #include iostre4m #inc1ude cstring using namespace...Ch. 12 - Each of the following programs or program segments...Ch. 12 - Soft Skills 30. You are a member of a...Ch. 12 - Prob. 1PCCh. 12 - Prob. 2PCCh. 12 - Prob. 3PCCh. 12 - Prob. 4PCCh. 12 - Name Arranger Write a program that asks for the...Ch. 12 - Prob. 6PCCh. 12 - Prob. 7PCCh. 12 - Prob. 8PCCh. 12 - Prob. 9PCCh. 12 - Password Verifier Imagine you are developing a...Ch. 12 - Prob. 11PCCh. 12 - Check Writer Write a program that displays a...Ch. 12 - Prob. 13PCCh. 12 - Dollar Amount Formatter Modify Program 12-13 by...Ch. 12 - Word Separator Write a program that accepts as...Ch. 12 - Prob. 16PCCh. 12 - I before e except after c A friend of yours who is...Ch. 12 - User Name Write a program that queries its...Ch. 12 - String Splitter Write a function vectorstring...Ch. 12 - Palindromic Numbers A palindromic number is a...
Knowledge Booster
Similar questions
- I need a function that takes a string and returns initials such as Bob Burnett becoming B.B. string CreateAcronym(string userPhrase);int main() {while (true){string userPhrase;getline(cin, userPhrase); if (userPhrase == "") {break; }cout << CreateAcronym(userPhrase) << endl;}return 0;}string createAcronym( const string && userPhrase ) {int i;string acronym;bool use_next = true; for (i=0; i < userPhrase.size(); i++){char character = userPhrase.at(i);int ascii = (int)character;if(ascii > 64 && ascii < 91 && use_next == true){acronym += character;use_next = false;} else if(ascii == 32){use_next=true;}else{use_next = false;}}return acronym;} Please fix my program using c++.arrow_forwardBinary to String Create a function binary_to_ascii_string() that converts binary information into ASCII characters. This accepts a list of binaries, binary_values, and returns them as a string. (Note that the binary strings have 8 characters.) An example is present in the photo below. Thank you!arrow_forward(JS)Write a function named "tweets" that takes a string as a parameter. If a message can hold at most 280 characters, calculate the smallest number of messages needed to hold all of the text in the input. The function should return the number it calculated.arrow_forward
- Q1 Write an assembly program in which a string called myStr is stored in the .data segment of the program (so, it is not entered by the user, you can store a string of your choice for this program). The .code in your assembly program reads all characters in the myStr and converts all upper-case letters in it to lower-case letters. Your program will not change other characters in myStr.arrow_forwardString Manipulation In this question, you will be implementing the following functions int findChar(char * str, char c); Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1 int replaceChar(char * str, char c1, char c2); Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0. int removeChar(char * str1, char * str2, char c); Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’ For example, if str1=”Hello World” and c=’l’ then the function should make str2=”He**o Wor*d” int isPalindrome(char * str) Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc. int reverseString(char…arrow_forward4. Complete the function show_upper. This function takes one parameter - a string (s). It should return a string made up of all the upper-case characters in s. For example, if s is “aBdDEfgHijK” then show_upper should return “BDEHK”. It should return the upper-case string - not print it. Do not change anything outside show_upper.arrow_forward
- 10.17: Morse Code Converter C++Morse code is a code where each letter of the English alphabet, each digit, and various punctuation characters are represented by a series of dots and dashes. Table 10-8 from the textbook shows part of the code. Write a program that asks the user to enter a string, and then converts that string to Morse code. Note that Morse code represents both upper and lower case letters so that both 'A' and 'a' will be converted to ".-". Input Validation.None. Instructor Notes: Note: You can use the Morse table in the book or this site (space isn't listed, but it is just mapped to a space). You will most certainly need to create two parallel arrays to map the characters to the Morse code strings.arrow_forwardC++ Create a function print_double_spaced(cs) that takes a C string as an argument and prints the characters of that string separated by a space. For example, the string hello world should be printed as h e l l o w o r l darrow_forwardCreate a function that takes a number (int) and returns a corresponding string of dashes. Examples: num_to_dashes(1) ➞ "-" num_to_dashes(5) ➞ "-----" num_to_dashes(3) ➞ "---"arrow_forward
- #include <iostream>#include <string>#include <climits> using namespace std;class BalancedTernary { protected: // Store the value as a reversed string of +, 0 and - characters string value; // Helper function to change a balanced ternary character to an integer int charToInt(char c) const { if (c == '0') return 0; return 44 - c; } // Helper function to negate a string of ternary characters string negate(string s) const { for (int i = 0; i < s.length(); ++i) { if (s[i] == '+') s[i] = '-'; else if (s[i] == '-') s[i] = '+'; } return s; } public: // Default constructor BalancedTernary() { value = "0"; } // Construct from a string BalancedTernary(string s) { value = string(s.rbegin(), s.rend()); } // Construct from an integer BalancedTernary(long long n) { if (n == 0) { value = "0"; return; } bool neg = n < 0; if (neg) n = -n; value = ""; while (n !=…arrow_forward21.1 LAB: Fun with characters Complete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" Use Python, please.arrow_forwardC++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education