CAMPBELL BIOLOGY - BIO 121 W/ACC >IC<
8th Edition
ISBN: 9781323423967
Author: Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 9TYK
A biochemist hopes to find a gene in human cells that codes for an important blood-clotting protein. She knows that the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotife sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
What would be a medical advantage of having a catalog of SNPs?
Chapter 12 Solutions
CAMPBELL BIOLOGY - BIO 121 W/ACC >IC<
Ch. 12 - Imagine you have found a small quantity of DNA....Ch. 12 - Which of the following would be considered a...Ch. 12 - The DNA profiles used as evidence in a murder...Ch. 12 - A paleontologist has recovered a tiny bit of...Ch. 12 - How many genes are there in a human sperm cell? a....Ch. 12 - When a typical restriction enzyme cuts a DNA...Ch. 12 - Why does DNA profiling rely on comparing specific...Ch. 12 - Recombinant DNA techniques are used to...Ch. 12 - A biochemist hopes to find a gene in human cells...Ch. 12 - Prob. 10TYK
Ch. 12 - Explain how you might engineer E. coli to produce...Ch. 12 - What is left for genetic researchers to do now...Ch. 12 - Today, it is fairly easy to make transgenic plants...Ch. 12 - In the not-too-distant future, gene therapy may be...Ch. 12 - The possibility of extensive genetic testing...Ch. 12 - SCIENTIFIC THINKING Scientists investigate...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the two advantages of using sequence analysis of ribosomal components in determining the relatedness of organisms? please explain why each is an advantage.arrow_forwardWhy do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas geneticistsstudying bacteria almost never do? Why might bacterial geneticists have difficulties constructing cDNA libraries even if they wanted to?arrow_forwardA researcher has isolated a restriction endonuclease that cleaves at only one particular 10- basepair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain.arrow_forward
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardIn order to make a plant gene sequence functional when added to a bacterial genome, what kinds of changes would you have to make to the plant gene sequence?arrow_forwardRefer to the figure. What method would you use if you wanted to determine the sequence of the cDNA of the peak protein? Briefly explain the sequencing methodarrow_forward
- Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′arrow_forwardIn a genomic analysis looking for a specific disease gene,one candidate gene was found to have a single-base-pairsubstitution resulting in a nonsynonymous amino acidchange. What would you have to check before concluding that you had identified the disease-causing gene?arrow_forwardHow did the private corporation Celera Genomics approach the sequencing of the human genome? What was the advantage of this approach?arrow_forward
- You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…arrow_forwardSuppose you are a research assistant in a lab studying dna-binding proteins. you have been given the amino acid sequences of all the proteins encoded by the genome of a certain species and have been asked to find candidate proteins that could bind dna. what type of amino acids would you expect to see in the dna-binding regions of such proteins?arrow_forwardDesign a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtgaarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License