CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
3rd Edition
ISBN: 9780136811206
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 8TYU
SCIENTIFIC INQUIRY
Imagine you want to study one of the mouse crystallins, proteins present in the lens of the eye. Assuming that the gene has been cloned, describe two ways to study its expression in the embryo.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Would gene chips containing bacterial DNA segments be useful for monitoring gene expression in a mammalian cell?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
Compare and contrast the formation of mRNA in bacterial and eukaryotic cells. How do the differences affect the way in which each type of mRNA is translated? Does one system have obvious advantage in term of energy cost? Which system offers greater opportunities for control of gene expression?
Chapter 15 Solutions
CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Prob. 1CCCh. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
The term ‘spore’.
Biology Science Notebook
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Physiology a. deals with the processes or functions of living things. b. is the scientific discipline that inve...
SEELEY'S ANATOMY+PHYSIOLOGY
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Homeotic (Hox genes in vertebrates) code for expression of that regulate the OD) Transcription factors, genes that determine segment identity and structure OC) Poly-A tails, that code for proteins that control muscle differentiation OE) Transcription factors, genes that control muscle differentiation OA) Operators, inducible genes coding for enzymes in metabolic pathwaysarrow_forwardBriefly explain the transcriptional regulation of mammalian gene expression? Please explain at your own words.arrow_forwardmRNA Comparison A scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene for this enzyme, and the scientist extracts mRNA transcribed from this gene as well as protein translated from it. The gene has three introns in its sequence. Use the passage to answer the question. Part A: If the researcher compares mRNA from inside the nucleus to mRNA from the ribosomes, what will be found? A. less mRNA in the nucleus B. shorter mRNA in the ribosomes C. identical mRNAs in both places D. mRNA covalently attached to protein in the nucleus Part B: Use the passage to answer the question. If the same scientist extracts the DNA for this gene and finds that it becomes methylated over the life of the organism, how will digestion change over time? A. It will occur at lower pH. B. It will rely more on this enzyme over time. C. It will use methylated copies of the enzyme. D. It will involve a lesser quantity of this enzyme over time.arrow_forward
- Select all the examples of mutations that are likely to have a global effect on gene expression. Check All That Apply a mutation in a splice donor recognition sequence within an snRNA gene a mutation that reduces expression of an rRNA a hypomorphic mutation in the catalytic site of RNA polymerase a silent mutation in a gene encoding a protein in the small ribosomal subunit a nonsense mutation in a gene encoding an ion channelarrow_forwardYou hope to study a gene that codes for a neurotransmitter protein produced in human brain cells. You know the amino acid sequence of the protein. Explain how you might (a) identify what genes are expressed in a specific type of brain cell, (b) identify (and isolate) the neurotransmitter gene, (c) produce multiple copies of the gene for study, and (d) produce large quantities of the neurotransmitter for evaluation as a potential medication.arrow_forwardCreate a Venn diagram to compare and contrast the process of gene expression in Bacteria versus eukaryotes. Remember that “gene expression” can include any part of transcription or translation. Try to be as thorough as you can about what aspects of this process are similar between the two taxa, and what characteristics are distinct to only Bacteria or eukaryotes. Plase include a minimum of 15 items in the Venn diagram.arrow_forward
- Discuss in your own wordings the concept of gene expression. proper explanation and diagramarrow_forward. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAarrow_forwardGene expression can be controlled with the help of RNA.Explain the method with an example.arrow_forward
- Why is regulating transcription the main way that cells control gene expression? A. Because transcription is the last step in gene expression, stopping here ensures that the cell has a stockpile of proteins to prepare them from all unexpected environmental changes. B. Because transcription involves interactions with DNA, preventing transcription reduces the changes of mutation in the cell’s genome. C. Because transcription is the first step in gene expression, stopping at transcription reduces the amount of energy and resources used by producing unnecessary gene products. D. Because transcription is the shortest step in gene expression, preventing transcription has little effect on the rate of protein production.arrow_forwardThe sequencing of entire genomes has made it possible to examine the level of gene expression in a particular cell or tissue by using oligonucleotide probes to assess the mRNA expression level from a particular gene. This is done most effectively through the use of what experimental technique?arrow_forwardCompare and contrast regulation of gene expression in prokaryotes vs. eukaryotes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY