IA MODIFIED MASTERING BIOLOGY WITH E TEX
IA MODIFIED MASTERING BIOLOGY WITH E TEX
12th Edition
ISBN: 9780136781752
Author: Urry
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 16, Problem 16.1CR

What does it mean wheti we say that the two DNA strands in the double helix are antiparallel? What would an end of the double helix look like if the strands were parallel?

Expert Solution
Check Mark
Summary Introduction

To explain: The meaning of the statement “the two strands in the double helix DNA are antiparallel”.

Introduction: DNA is a double-stranded molecule that consists of two strands of nucleotides. The bases in one strand are complementary to the bases on the other strand. During DNA replication, the two strands of parent DNA molecule separate. The parent strands act as templates along which the DNA polymerases add up the complementary base pairs in the context of base-pairing rules.

Explanation of Solution

A deoxyribonucleic acid (DNA) molecule consists of two polynucleotide chains that associate as a double helix structure. The polarity in the DNA chain is referred to as 5ʹ end and the other as 3ʹ end. One end of DNA consists of a phosphate attached to a 5ʹ deoxyribose carbon (5ʹ end), and the other end has a hydroxyl group that is attached to a 3ʹ deoxyribose carbon (3ʹ end). The nucleotides are linked by phosphodiester bonds through 5ʹ-P of one sugar and 3ʹ-OH group of the next sugar. In a double-stranded DNA, one strand is “complemented” by the other strand. If one DNA strand runs in the 5ʹ→3ʹ direction, its complementary strand would run in the 3ʹ→5ʹ direction. Thus, the two strands are antiparallel to each other.

Expert Solution
Check Mark
Summary Introduction

To determine: The ends of a double helix DNA if the two DNA strands in the double helix were parallel.

Introduction: DNA or deoxyribonucleic acid carries hereditary information from one generation to another. DNA replication is a process that takes place in every biological cell. It involves the coping and producing of two identical copies of a cell from their parent DNA molecule.

Explanation of Solution

If two DNA strands run in parallel directions, they would run in the same direction, that is, they would both run in the 5′→3′ direction. In such a condition, in the same side, an end of the DNA molecule would have two 5′ ends and two 3′ ends.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license