Study Guide for Campbell Biology
10th Edition
ISBN: 9780321833921
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson, Martha R. Taylor
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 5TYU
Which component is not directly involved in translation?
(A) GTP
(B) DNA
(C) tRNA
(D) ribosomes
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?
Once translated into proteins:
(a) How many nucleotides are there?
(b) How many codons are there?
(c) How many amino acids?
Which of the following best describes tRNA?
a. Provides the instructions for the amino acid sequence of a polypeptide
b. Complexes with ribosomal proteins to form ribosomes
c. Used for eukaryotic RNA processing
d. Transports amino acids to ribosomes during translation
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.1 - Prob. 4CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - Prob. 3CCCh. 17.3 - Prob. 1CCCh. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CC
Ch. 17.4 - What two processes ensure that the correct amino...Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - Prob. 4CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - Prob. 11TYUCh. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some species of bacteria that live at the surface of sediment on the bottom of lakes are capable of using eithe...
Biology: Life on Earth with Physiology (11th Edition)
Explain why hyperthermophiles do not cause disease in humans.
Microbiology with Diseases by Taxonomy (5th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual for Holes Human Anatomy & Physiology Fetal Pig Version
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What evidence supports the view that ribosomal RNAs are a more important component of the ribosome than the ribosomal proteins?arrow_forwardWhat do you mean by mRNA and tRNA?arrow_forwardTranslation is a process which is best symbolized by a. RNA --> DNA b. DNA --> RNA c. DNA --> protein d. RNA --> protein e. Protein --> RNAarrow_forward
- What are Cyclin and mRNA? How are they related?arrow_forwardDiscuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?arrow_forwardUsing seven numbered steps, describe the process of translation.arrow_forward
- in lecture we learned that translation is the process of what happens when a strand of RNA is translated into protein with the use of genetic information from RNA. i understand that the process is very different from eukaryotes and prokaryotes. My question is what would happen if the processes were switched? like the process for eukaryotes was now for prokaryotes and vice versa. Would it work but just not be as efficient or not work at all?arrow_forwardPart A) In your own words describe what happens in transcription and translation Include which types of nucleic acids are involved in each step Describe the function of each type of nucleic acid in the process of making proteins Part B) Also, explain how two nucleic acids "recognize" or "talk" to each otherarrow_forwardDescribe in Your own words the Termination step of Translation process?arrow_forward
- Compare and contrast the processes of transcription and translationarrow_forwardWhat is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…arrow_forwardWhich component is not directly involved in translation?(A) GTP(B) DNA(C) tRNA(D) ribosomesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license