Concept explainers
Introduction:
A gene is a functional unit of the DNA (deoxyribonucleic acid), which codes for one or more proteins. It is transcribed into mRNA (messenger RNA) through a process called transcription. This process requires an enzyme called RNA (ribonucleic acid) polymerase. This enzyme recognizes a sequence in the gene known as the promoter region. This signals it to begin transcription and it synthesizes mRNA from that gene. This mRNA is then translated into the protein that mRNA codes for using translation machinery that is ribosomes, tRNA (transfer RNA) molecules, and enzymes. The mRNA is held in place by the ribosome. Codons in the mRNA are recognized by tRNA molecules, which bring in the corresponding amino acids and peptide bonds are formed between these resulting in the production of a protein.
Want to see the full answer?
Check out a sample textbook solutionChapter 17 Solutions
MasteringBiology With eText - Access
- Use the diagram of a gene below to answer the question. The site of transcription initiation is indicated by the arrow. Which letter best corresponds to the location where alternative proteins can be produced from the same gene?arrow_forwardA. Which genes could be used to monitor the process of the disease? B.  If you worked for a drug company developing a treatment for the cancer, which genes would you target to turn on in cancer cells? C. Which genes would you target to turn off in cancer cells?arrow_forwardAssess the statement that cancer is, in many cases, an epigenetic disease.arrow_forward
- Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense strand) in your response: 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’arrow_forwardWhat is the role of Proteinase K in DNA isolation? A. Inhibit enzymes B Catalyze breakdown of nuclei acids C Degrade proteins D Remove disultide bongs in proteinsarrow_forwardA promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forward
- using a table, compare how histones and micro RNA control gene expressionarrow_forwardWhich describes the role of primase during replication? a. It catalyzes the formation of phosphodiester bonds using NTPs as substrates. \ b. It coordinates synthesis of the leading strand and the lagging strand. c. It functions as a holoenzyme that polymerizes in the 3’→ 5’ direction. d. It uses an exonuclease activity to remove incorrect nucleotides.arrow_forwardThe structure of DNA revealed how information is stored in the base sequence along a DNA strand. But what information is stored and how is it expressed?arrow_forward
- What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c. interpretation of the genetic code d. the exact copying of the DNA code into two new moleculesarrow_forwardWhat do genetic engineers use to create the “sticky ends” needed to splice two fragments of DNA together? a.) an amino acid sequence b.) DNA ligase c.) restriction enzymes d.) mRNAarrow_forwardWhat is the advantage of studying the mRNA present in a cell rather than the DNA? A. The mRNA is more chemically stable at room temperature. B. The mRNA identifies which genes are expressed. C. The mRNA identifies inheritance patterns. D. The mRNA is better able to undergo PCR.arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College