BIOLOGY DUAL ENROLLMENT VERSION
12th Edition
ISBN: 9780136681311
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17.1, Problem 2CC
What polypeptide product would you expect from a poly-G mRNA that is 30
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
Consider the following mRNA sequence: 5'-UUG ACC GAC-3'.
Note: Reference the Genetic code table for additional information.
Part: 0 / 5
Part 1 of 5
What amino acid sequence is coded for by this mRNA?
☑
Sequence 1 : TACGCTACGGTAATC
Sequence 2: TACGCTACTATCGTA
Chapter 17 Solutions
BIOLOGY DUAL ENROLLMENT VERSION
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17.5 - Prob. 4CCCh. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Prob. 2TYUCh. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Prob. 4TYUCh. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forwardGiven the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forward
- In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of amino acid in the protein formed by this mRNA molecule?arrow_forwardAfter the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each other?arrow_forwardWhat is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?arrow_forward
- Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can result from alternative splicing of this RNA.arrow_forwardThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’arrow_forwardThe base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.arrow_forward
- Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestionarrow_forwardPolypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?arrow_forwardDetermine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license