BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.5, Problem 1CS
Summary Introduction
To create: A pair of models that depict the key difference between the forms of glycosyltransferase encoded by the IA and IB alleles.
Introduction: Blood type is determined by a gene that has three different alleles. This gene codes for an enzyme called glycosyltransferase, this enzyme is useful for the synthesis of a specific polysaccharide on the surface of red blood cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Question:
Explain how epigenetic marks and genomic imprinting are related. Provide a drawing to illustrate your point.
a. Why does a shift from grain to meat diets create more demand for cereals?
b. What is the name of this emerging area of research where a 250kg cow produces 200g of protein every day but 250g of Methylophillus methylotrophus can produce 25 tonnes of protein? State the advantages of this area of research.
Exercise Ill:
For this lab exercise, you will evaluate a human pedigree for a particular disease, Huntington disease.
Huntington disease is a progressive neurodegenerative disorder that is inherited in an autosomal
dominant pattern. The disease presents around the age of 40, although there are juvenile onset
forms of the disease. Suppose that there is a SNP closely linked to the Huntington gene, so close that
there is little crossing over between the SNP and the Huntington gene.
Consider the following family:
Velma's father, now deceased, had Huntington Disease, but neither of his parents had the disease;
therefore, it was a new mutation that caused his disease. Velma's mother does not have the disease.
Before his death, Velma's father was genotyped for the SNP marker that is linked to the Huntington
gene, and it was determined that he has alleles A1 and A2. Velma's mother was also genotyped and
has alleles A1 and A3. Velma has one brother (age 45) who has Huntington Disease, and…
Chapter 17 Solutions
BIOLOGY-TEXT
Ch. 17.1 - Prob. 1CCCh. 17.1 - Prob. 2CCCh. 17.1 - Prob. 3CCCh. 17.1 - Prob. 4CCCh. 17.1 - Mendels Laws of Inheritance Concept Check: What...Ch. 17.2 - Prob. 1CSCh. 17.2 - Prob. 2CSCh. 17.2 - Prob. 1CCCh. 17.3 - Prob. 1CCCh. 17.3 - Prob. 2CC
Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 1EQCh. 17.4 - Prob. 2EQCh. 17.4 - Prob. 3EQCh. 17.5 - Prob. 1CSCh. 17.5 - Prob. 1CCCh. 17.6 - Prob. 1CCCh. 17 - Prob. 1TYCh. 17 - During which phase of nuclear division does the...Ch. 17 - Prob. 3TYCh. 17 - Which of Mendels laws cannot be observed in a...Ch. 17 - During a __________blank, an individual with the...Ch. 17 - Prob. 6TYCh. 17 - Prob. 7TYCh. 17 - A hypothetical flowering plant species produces...Ch. 17 - Genes located on a sex chromosome are said to be...Ch. 17 - Prob. 10TYCh. 17 - Prob. 1CQCh. 17 - A cross is made between individuals having the...Ch. 17 - Core Concept: Systems We can view life as a...Ch. 17 - Discuss the principles of the chromosome theory of...Ch. 17 - When examining a human pedigree, what patterns do...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.arrow_forwardThink Critically. Provide a concise explanation of your answer. A mutation on an autosome causes a particular protein to be overproduced, and the excess protein accumulates in the liver and damages it. Would the resulting disorder most likely be inherited in an autosomal dominant or recessive pattern? Expression of the SYR gene on the Y chromosome gives rise to the male phenotype in humans. What do you think the inheritance pattern of SYR alleles is called? 22q11.2 deletion syndrome, also called DiGeorge syndrome, causes atypical parathyroid glands, a heart defect, and an underdeveloped thymus gland. About 85% of patients have a microdeletion of part of chromosome 22. A girl, her mother, and a maternal aunt have very mild DiGeorge syndrome. They all have a reciprocal translocation of chromosomes 22 and 2. How can a microdeletion and a translocation cause the same symptoms? Why were the people with the translocation less severely affected than the people with microdeletion? What other…arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).arrow_forward
- What is dosage compensation? Give its importance. explain pleasearrow_forward. You need to prepare 500 μL of a 250 µg/mL bovine gamma globulin solution, for one of your protein standards in the Bradford assay. The available bovine gamma globulin in the lab is in the form of a 2 mg/mL stock solution, and it can be diluted with deionized water. Describe or show below how you would create your desired 250 µg/mL solution.arrow_forwardGenetics of man question:Describe the molecular genetics analysis for the GATA binding protein gene and consider the possibility of lethality and functional redundancy and experimental strategies to address possibilities.arrow_forward
- Genetics of man question: Provide a brief description of on the SNP for the gene GATA binding protein 3 (GATA3)and as well as the gene .arrow_forwardTalk about the challenges involved in determining the genetic components of polygenic illnesses. Explain complementation groups and how the biochemical underpinnings of disease are determined using them. Hereditary illnesses of genomic instability include Werner syndrome, Bloom syndrome, XP, ataxia-telangiectasia, and Fanconi anemia. Which of these ailments has molecular mechanisms behind it? Which kind of genetic instability is connected to which disorder?.arrow_forwardGene Interaction and Epistasis Hair color is due to the presence of melanin. There are two types of melanin produced by melanocytes. One is eumelanin, which is responsible for black (homozygous), brown (heterozygous), and blond (recessive) hair colors. The other is pheomelanin, which is responsible for red hair color. During melanin synthesis, MCR1gene converts pheomelanin to eumelanin. However, a variant of the MCR1 gene (MCR1variant), prevents this conversion. A cross between a blond-haired mother and a red-haired father produced 100% brown-haired children. When they came of age, one child married a double heterozygote, and both were blessed with 7 children; 2 with black hair, 2 with brown hair, 1 with blond hair, and 2 with red hair. Using the 7-step method, determine the genotypes of the P1, the F1, and the F2s. BOX your answers (if handwritten) or HIGHLIGHT your answers (if encoded). STEP 1: ________________________________________________________ STEP 2:…arrow_forward
- Briefly elaborate Major considerations in dosage form design with example" ? Please briefly explain at your own easy words.arrow_forwardGenetics of man question:Provide the expression pattern of the gene ,GATA binding 3 (GATA3).arrow_forward- 1 attachment If a pure line wheat plant with a colored kernel (geniotype = DDEE) is crossed to plant with white kernels (genotype = ddee) and the resulting. F1 plants are selfed, a modification of the dihybrid 9:3:3:1 ratio will be produced. What is the biochemical explanation for the genotypes: (a) D_E_ and (b) D_ee ? A. Presence of functional enzymes from both genotypes (a) and (b) B. Presence of functional enzymes from genes in (a) C. Absence of a functional enzyme from the D gene pair D. Presence of functional enzymes from genes in (a) and absence of a functional enzyme from the D gene pair in (b) E. None of the above.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License