BIOLOGY CONNECT ACCESS CARD
12th Edition
ISBN: 9781264037452
Author: Raven
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18, Problem 1S
You are in the early stages of a genome-sequencing project. You have isolated a number of clones from a bacterial artificial chromosome (BAC) library and mapped the inserts in these clones using STSs. Use the STSs shown to align the clones into a contiguous sequence of the genome (a contig).
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment.
Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers.
Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand).
Please organize your response so that each primer, and associated information, is separated by at least one blank line
5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
In the practical you have been analysing a human genomic library. You know from your calculations that only a small proportion of the human genome is represented, even when the entire class results are considered. Therefore, the chance of finding a particular single-copy gene in your library is very small.
Outline a strategy for constructing a genomic DNA library more representative of the entire human genome. You will need to consider alternative vectors and the efficiency of transformation of the bacterial cells.
Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp.
A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?
Chapter 18 Solutions
BIOLOGY CONNECT ACCESS CARD
Ch. 18.1 - Prob. 1LOCh. 18.1 - Describe the pros and cons of restriction mapping,...Ch. 18.1 - Prob. 3LOCh. 18.2 - Discriminate between dideoxy terminator sequencing...Ch. 18.2 - Prob. 2LOCh. 18.3 - Describe the findings of the Human Genome Project.Ch. 18.3 - Prob. 2LOCh. 18.3 - Prob. 3LOCh. 18.4 - Prob. 1LOCh. 18.4 - Prob. 2LO
Ch. 18.4 - Prob. 3LOCh. 18.5 - Prob. 1LOCh. 18.5 - Prob. 2LOCh. 18.5 - Prob. 3LOCh. 18.6 - Prob. 1LOCh. 18 - Prob. 1DACh. 18 - If the human genome contains approximately 3...Ch. 18 - Prob. 1IQCh. 18 - Prob. 2IQCh. 18 - Prob. 3IQCh. 18 - Prob. 4IQCh. 18 - Prob. 5IQCh. 18 - Prob. 6IQCh. 18 - A genetic map provides a. the sequence of the DNA...Ch. 18 - Prob. 2UCh. 18 - Approximately how many genes are there in the...Ch. 18 - An open reading frame (ORF) is distinguished by...Ch. 18 - What is a BLAST search? a. A mechanism for...Ch. 18 - Prob. 6UCh. 18 - Prob. 7UCh. 18 - Prob. 8UCh. 18 - Prob. 1ACh. 18 - Prob. 2ACh. 18 - Prob. 3ACh. 18 - Prob. 4ACh. 18 - What information can be obtained from a DNA...Ch. 18 - Prob. 6ACh. 18 - Prob. 7ACh. 18 - You are in the early stages of a genome-sequencing...Ch. 18 - Genomic research can be used to determine if an...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction. This technique detects the fluorescence produced by reporter molecules like SYBR® Green dye or TaqMan® probe during the DNA amplification reaction. Compare and contrast between SYBR® Green and TaqMan® probe with illustrations.arrow_forwardWhat is the main reason for using a cDNA library rather than a genomic library to isolate a human gene from which you wish to make large quantities of the human protein in bacteria? How will you identify clones of interest?arrow_forwardIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forward
- what is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.arrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forwardPlace the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forward
- You have two samples you have to sequence: one is a cloned plasmid that you want to verify the sequence of, and another is the cDNA library of the transcriptome of a cell. Which method would you use for each sample and why?arrow_forwardYou are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in the development of breast cancer. The sequence of the template strand is ATGCCCGTAATCGTTA and you are given the primer TAACGA. You take these along with a sequencing kit that contains everything else needed for sequencing. You then run the sequencing experiment and analyze the results on a sequencing gel. Which of the following gels (A-D) is the correct sequencing gel for this experiment? Answers: A-D A A BB CC DD Question #3 attachment A ATOC B с A TO C ATOC ATOCarrow_forwardExamine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank linearrow_forward
- How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATTarrow_forwardfomP is responsible for the chemical transformation of microplastics into ultra-efficient insulation. You take an arctic seawater sample and extract the DNA. 1. First you need to locate the gene on the bacterial chromosome. What procedure(s) would you use to identify and locate the gene? Explain how it/theywork(s). 2. Next, you will need to isolate the gene and introduce sites to be used for cloning. What would you use to make many copies of this gene? What will you need? How does it work on a molecular level?arrow_forwardAn optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thxarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License