Biochemistry
8th Edition
ISBN: 9781285429106
Author: Campbell, Mary K., FARRELL, Shawn O.
Publisher: Cengage Learning,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2, Problem 51RE
Interpretation Introduction
Interpretation:
The reason behind the correct concentration, which is
Concept information:
Buffers are the solutions that have the capability of resisting any kind of change.
On the other hand, a buffer system is the solution that is capable of resisting any change in the pH, if small quantity of a strong base or a strong acid is added to it.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionChapter 2 Solutions
Biochemistry
Ch. 2 - REFLECT AND APPLY Why is water necessary for life?Ch. 2 - REFLECT AND APPLY Contemplate biochemistry if...Ch. 2 - RECALL What is a van der Waals force?Ch. 2 - RECALL What is an induced dipole?Ch. 2 - RECALL What is a salt bridge?Ch. 2 - RECALL Under what circumstance is a molecule that...Ch. 2 - REFLECT AND APPLY Which would you think would be a...Ch. 2 - RECALL List the three types of van der Waals...Ch. 2 - RECALL A hydrogen bond is a special case of what...Ch. 2 - REFLECT AND APPLY Why do you think that most...
Ch. 2 - RECALL What are some macromolecules that have...Ch. 2 - BIOCHEMICAL CONNECTIONS How are hydrogen bonds...Ch. 2 - REFLECT AND APPLY Rationalize the fact that...Ch. 2 - REFLECT AND APPLY Draw three examples of types of...Ch. 2 - RECALL What are the requirements for molecules to...Ch. 2 - REFLECT AND APPLY Many properties of acetic acid...Ch. 2 - REFLECT AND APPLY How many water molecules could...Ch. 2 - REFLECT AND APPLY Both RNA and DNA have negatively...Ch. 2 - RECALL Identify the conjugate acids and bases in...Ch. 2 - RECALL Identify conjugate acids and bases in the...Ch. 2 - REFLECT AND APPLY Aspirin is an acid with a pKa of...Ch. 2 - RECALL Why does the pH change by one unit if the...Ch. 2 - MATHEMATICAL Calculate the hydrogen ion...Ch. 2 - MATHEMATICAL Calculate the hydrogen ion...Ch. 2 - MATHEMATICAL Calculate the hydroxide ion...Ch. 2 - RECALL Define the following: (a) Acid dissociation...Ch. 2 - REFLECT AND APPLY Look at Figure 2.17. If you did...Ch. 2 - BIOCHEMICAL CONNECTIONS List the criteria used to...Ch. 2 - BIOCHEMICAL CONNECTIONS What is the relationship...Ch. 2 - MATHEMATICAL What is the [CH3COO]/[CH3COOH] ratio...Ch. 2 - MATHEMATICAL What is the [CH3COO]/[CH3COOH] ratio...Ch. 2 - MATHEMATICAL What is the ratio of TRIS/TRIS-H+ in...Ch. 2 - MATHEMATICAL What is the ratio of HEPES/HEPES-H+...Ch. 2 - MATHEMATICAL How would you prepare 1 L of a 0.050...Ch. 2 - MATHEMATICAL The buffer needed for Question 35 can...Ch. 2 - MATHEMATICAL Calculate the pH of a buffer solution...Ch. 2 - MATHEMATICAL Calculate the pH of a buffer solution...Ch. 2 - MATHEMATICAL Calculate the pH of a buffer solution...Ch. 2 - MATHEMATICAL A catalog in the lab has a recipe for...Ch. 2 - MATHEMATICAL If you mix equal volumes of 0.1 M HCl...Ch. 2 - MATHEMATICAL What would be the pH of the solution...Ch. 2 - MATHEMATICAL If you have 100 mL of a 0.10 M TRIS...Ch. 2 - MATHEMATICAL What would be the pH of the solution...Ch. 2 - MATHEMATICAL Show that, for a pure weak acid in...Ch. 2 - MATHEMATICAL What is the ratio of concentrations...Ch. 2 - BIOCHEMICAL CONNECTIONS You need to carry out an...Ch. 2 - Prob. 48RECh. 2 - Prob. 49RECh. 2 - BIOCHEMICAL CONNECTIONS Which of the buffers shown...Ch. 2 - Prob. 51RECh. 2 - REFLECT AND APPLY In Section 2-4, we said that at...Ch. 2 - MATHEMATICAL Define buffering capacity. How do the...Ch. 2 - BIOCHEMICAL CONNECTIONS If you wanted to make a...Ch. 2 - BIOCHEMICAL CONNECTIONS We usually say that a...Ch. 2 - RECALL What quality of zwitterions makes them...Ch. 2 - Prob. 57RECh. 2 - Prob. 58RECh. 2 - Prob. 59RECh. 2 - BIOCHEMICAL CONNECTIONS A frequently recommended...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- REFLECT AND APPLY Would you expect cross-linking to play a role in the structure of polysaccharides? If so, how would the cross-links be formed?arrow_forwardREFLECT AND APPLY The enzyme D-amino acid oxidase has a very high turnover number because the D-amino acids are potentially toxic. The KM for the enzyme is in the range of 1 to 2 mM for the aromatic amino acids and in the range of 15 to 20 mM for such amino acids as serine, alanine, and the acidic amino acids. Which of these amino acids are the preferred substrates for the enzyme?arrow_forwardREFLECT AND APPLY The process of protein folding is spontaneous in the thermodynamic sense. It gives rise to a highly ordered conformation that has a lower entropy than the unfolded protein. How can this be?arrow_forward
- REFLECTANDAPPLY Suppose that you are studying a protein involved in transporting ions in and out of cells. Would you expect to find the nonpolar residues in the interior or the exterior? Why? Would you expect to find the polar residues in the interior or the exterior? Why?arrow_forwardREFLECT AND APPLY Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit, instead of an 80S subunit.arrow_forwardREFLECT AND APPLY Referring to Question 23, how would you purify protein X using ion-exchange chromatography if it turns out the protein is only stable at a pH between 6 and 6.5?arrow_forward
- MATHEMATICAL What would be the pH of the solution described in Question 41?arrow_forwardREFLECT AND APPLY Comment on the energetics of protein folding in light of the information in this chapter.arrow_forwardREFLECT AND APPLY You are in the process of determining the amino acid sequence of a protein and must reconcile contradictory results. In one trial, you determine a sequence with glycine as the N-terminal amino acid and asparagine as the C-terminal amino acid. In another trial, your results indicate phenylalanine as the N-terminal amino acid and alanine as the C-terminal amino acid. How do you reconcile this apparent contradiction?arrow_forward
- REFLECT AND APPLY Common proteins are polymers of 20 different amino acids. How big a protein (how many amino acid residues) would be necessary to have an Avogadros number of possible sequences?arrow_forwardREFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG3' Reverse primer 5'TTCTAAGAAACTGTTAAGG3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC3' Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG3' Reverse primer 5'CGGACCTTCATTGGCAATTCGA3'arrow_forwardREFLECT AND APPLY Draw Haworth projection formulas for dimers of glucose with the following types of glycosidic linkages: (a) A (14) linkage (both molecules of glucose in the form) (b) An ,(11) linkage (c) A (16) linkage (both molecules of glucose in the form)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY