Starting Out with C++ from Control Structures to Objects Plus MyLab Programming with Pearson eText -- Access Card Package (9th Edition)
9th Edition
ISBN: 9780134544847
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 20, Problem 14RQE
#include <iostream>
#include <string>
using namespace std;
void function(string, int, int);
int main()
{
string mystr = "Hello";
cout ≪ mystr ≪ endl;
function(mystr, 0, mystr.size());
return 0;
}
void function(string str, int pos, int size)
{
if (pos < size)
{
function(str, pos + 1, size);
cout ≪ str[pos];
}
}
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
C++ Code: DNA Sequence
The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence.
For example,
if input sequence is:
AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA
then
numOccurrences("AGAT", sequence) should return 5
numOccurrences("TATC", sequence) should return 8
if input sequence is:
AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG
then
numOccurrences("AATG", sequence) should return 7
numOccurrences("TATC", sequence) should return 4
if input sequence is:…
String Manipulation
In this question, you will be implementing the following functions
int findChar(char * str, char c);
Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1
int replaceChar(char * str, char c1, char c2);
Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0.
int removeChar(char * str1, char * str2, char c);
Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’
For example, if
str1=”Hello World” and
c=’l’ then the function should make
str2=”He**o Wor*d”
int isPalindrome(char * str)
Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc.
int reverseString(char…
c++
A palindrome is a string that reads the same both forward and backward. For example, the string "madam" is a palindrome. Write a program that uses a recursive function to check whether a string is a palindrome. Your program must contain a value-returning recursive function that returns true if the string is a palindrome and false otherwise. Do not use any global variables; use the appropriate parameter.
Chapter 20 Solutions
Starting Out with C++ from Control Structures to Objects Plus MyLab Programming with Pearson eText -- Access Card Package (9th Edition)
Ch. 20.2 - What happens if a recursive function never...Ch. 20.2 - What is a recursive functions base case?Ch. 20.2 - Prob. 20.3CPCh. 20.2 - What is the difference between direct and indirect...Ch. 20 - What is the base case of each of the recursive...Ch. 20 - What type of recursive function do you think would...Ch. 20 - Which repetition approach is less efficient, a...Ch. 20 - When should you choose a recursive algorithm over...Ch. 20 - Explain what is likely to happen when a recursive...Ch. 20 - The _____________ of recursion is the number of...
Ch. 20 - Prob. 7RQECh. 20 - Prob. 8RQECh. 20 - Prob. 9RQECh. 20 - Write a recursive function to return the number of...Ch. 20 - Write a recursive function to return the largest...Ch. 20 - #include iostream using namespace std; int...Ch. 20 - Prob. 13RQECh. 20 - #include iostream #include string using namespace...Ch. 20 - Iterative Factorial Write an iterative version...Ch. 20 - Prob. 2PCCh. 20 - Prob. 3PCCh. 20 - Recursive Array Sum Write a function that accepts...Ch. 20 - Prob. 5PCCh. 20 - Prob. 6PCCh. 20 - Prob. 7PCCh. 20 - Prob. 8PCCh. 20 - Prob. 9PCCh. 20 - Prob. 10PCCh. 20 - Prob. 11PCCh. 20 - Ackermanns Function Ackermanns Function is a...
Additional Engineering Textbook Solutions
Find more solutions based on key concepts
Use the following tables for your answers to questions 3.7 through 3.51 : PET_OWNER (OwnerID, OwnerLasst Name, ...
Database Concepts (7th Edition)
How is a constructor used?
Starting out with Visual C# (4th Edition)
What are the advantages in implementing a language with a pure interpreter?
Concepts Of Programming Languages
Suppose that we add the following method to the class SalesReporter in Listing 7.4 so that a program using this...
Java: An Introduction to Problem Solving and Programming (8th Edition)
Give a definition for a class TitledEmployee that is a derived class of the base class SalariedEmployee given i...
Problem Solving with C++ (10th Edition)
A contractor uses a blueprint to build a set of identical houses. Are classes analogous to the blueprint or the...
Starting Out with Java: Early Objects (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- he function drawFractalLine is recursive. Write a script that draws the Koch snowflake. Define a function main that will draw a Koch snowflake with the following parameters when the program is run: Width = 200 Height = 200 Size = 150 Level = 4arrow_forward(Variable-Length Argument List: Calculating Products) Write a program that calculates theproduct of a series of integers that are passed to function product using a variable-length argumentlist. Test your function with several calls, each with a different number of arguments.arrow_forwardC++ ---- (the bold is code)------ Consider the function interface below: bool isSame(int x, double y); Write a line of code that declares a pointer named Funprt that points to this function.arrow_forward
- Create a function called reverse() that has a string parameter. The function reverses the characters of the string locally. ( in C language)arrow_forwardWrite these codes in c language please. Thank you in advance 1. Define a function PrintFeetInchShort(), with int parameters numFeet and numInches, that prints using ' and " shorthand. End with a newline. Remember that "\n" in a string literal starts a new line. Ex: PrintFeetInchShort(5, 8) prints:5' 8" 2. Write a function so that the main() code below can be replaced by the simpler code that calls function MphAndMinutesToMiles(). Original main(): int main(void) { double milesPerHour; double minutesTraveled; double hoursTraveled; double milesTraveled; scanf("%lf", &milesPerHour); scanf("%lf", &minutesTraveled); hoursTraveled = minutesTraveled / 60.0; milesTraveled = hoursTraveled * milesPerHour; printf("Miles: %lf\n", milesTraveled); return 0; } 3. Define stubs for the functions called by the below main(). Each stub should print "FIXME: Finish FunctionName()" followed by a newline, and should return -1. Example output:FIXME: Finish GetUserNum() FIXME: Finish GetUserNum()…arrow_forwardIn C++ commas must be there. main.cpp #include <vector>#include <string>#include <iostream> using namespace std; // TODO: Write method to create and output all permutations of the list of names.void PrintAllPermutations(const vector<string> &permList, const vector<string> &nameList) { } int main() { vector<string> nameList; vector<string> permList; string name; // TODO: Read in a list of names; stop when -1 is read. Then call recursive method. return 0;}arrow_forward
- Write a function findLetter based on the following rules: It takes a string named str and a character named ch as parameter, returns the index of the first occurrence of the character ch if the str string contains the character ch; If the relevant character is not found in the string, write a function that returns -1. Call the function inside the main function and test it. You should use the prototype given below: int findLetter (char str [], char ch)arrow_forwardIn c++, please and thank you! Write a function that dynamically allocates an array of integers. The function should accept an integer argument indicating the number of elements to allocate. The function should return a pointer to the array.arrow_forward8.10 (Appending Part of a String) Write a program that uses function strncat to append part of a string to another string. The program should input the strings, and the number of characters to be appended, then display the first string and its length after the second string was appended. **Note solve question without using pointers in c languagearrow_forward
- MULTIPLE FUNCTIONS AND RECURSIVE FUNCTIONS Use #include<stdio.h>arrow_forwardPYTHON CS1 PROBLEM (NO LOOPS) Define a recursive function that takes two strings str1 and str2 as parameters. It returns True if str1 is a suffix of str2, otherwise it should return False.For example: If str1 = True. If str1 = False. If str1 = If str1 = If str1 = If str1 = “washer” and str2 = “dishwasher” then your function should return “wash” and str2 = “dishwasher” then your function should return “” and str2 = “test” then your function should return True. “test” and str2 = “” then your function should return False.“” and str2 = “” then your function should return True.“test” and str2 = “test” then your function should return True.arrow_forward(Square of Asterisks) Write a function that displays a solid square of asterisks whose side isspecified in integer parameter side. For example, if side is 4, the function displays: **** **** **** ****arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology Ptr
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Introduction to Variables; Author: Neso Academy;https://www.youtube.com/watch?v=fO4FwJOShdc;License: Standard YouTube License, CC-BY