Concept explainers
Introduction:
The way, in which the
Answer to Problem 1TYK
Correct answer:
The ORF in bacteria is the section of DNA or deoxyribonucleic acid that codes for a protein as it has a start as well as a stop codon that flanks hundreds of nucleotides.
Explanation of Solution
Explanation/justification for the correct answer:
Option (c) is given that the ORF is that section of DNA, which have a start codon and a stop codon that lie either before and after the nucleotide stretch. The ORFs are a part of reading frames in molecular biology. It is a stretch of codons, which is found in genes. They are generally continuous in nature.
This stretch of codon has a start codon and a stop codon. In an ORF, the start codon indicates the start of the translation. The end of the transcription of the gene is the site where the codon stops. It is generally located after the ORF. Hence, option (c) is correct.
Explanation for the incorrect answers:
Option (a) is given that the ORFs are the genes, whose functions are already known. The genes whose functions are already known are the protein-coding genes. They are represented by expressed sequence tag. The ORFs, which are found using programming tools are compared with the sequence of the already known genes from another species through a computer program. So, it is an incorrect option.
Option (b) is given that the ORF is a DNA segment, which codes for a protein because it is similar to complementary DNA or cDNA. A cDNA is a DNA that is synthesized from a single strand of RNA. It is used in the cloning process of the gene in prokaryotes. Whereas, the ORFs, are the segments that are found in the DNA through the process of transcription. So, it is an incorrect option.
Option (d) is given that the ORFs are any member of the gene family. However, the ORFs are the DNA segments, which are found in the gene with the help of the computer programs. It is a part of DNA that transcribes and then translates to form the proteins. So, it is an incorrect option.
Hence, options, (a), (b), and (d) are incorrect.
Therefore, it can be said that the ORF in bacteria is the DNA sections that is thought to code for a protein. They comprise of a start codon and a stop code that flanks the hundreds of nucleotides.
Want to see more full solutions like this?
Chapter 21 Solutions
Biological Science (Custom)
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forwardWhy was the cold ethanol added to the soap and salt mixture? A To digest the cell walls B To dissolve the RNA C To emulsify lipids and remove large cellular debris D To precipitate the DNA E To denature the cytoplasmic proteinsarrow_forward
- involved in the transfer of multiple drug resistance from one cell to another? * a.Transposition b. Conjugation with a cell with chromosomal drug resistance appears in the genome of a bacteriophage that has infected it. c. Transformation of chromosomal genes d. Conjugation with a cell with a free plasmid carrying drug resistancearrow_forwardWhich one is an example of nucleic acid hybridization? A the template and newly synthesized DNA strands in replication B reverse transcription of a human RNA into cDNA C association of two strands, one synthetic, by complementarity D synthesis of copy strands by PCR E gene cloning in bacteriaarrow_forwardWhich technique allows a researcher to change a single specific nucleotide in a gene sequence in vitro? a. The CRISPR-Cas9 system b. PCR-based random mutagenesis c. PCR-based site-specific mutagenesis d. RT-PCRarrow_forward
- Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense strand) in your response: 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’arrow_forwardWhat is the advantage of studying the mRNA present in a cell rather than the DNA? A. The mRNA is more chemically stable at room temperature. B. The mRNA identifies which genes are expressed. C. The mRNA identifies inheritance patterns. D. The mRNA is better able to undergo PCR.arrow_forwardUse the diagram of a gene below to answer the question. The site of transcription initiation is indicated by the arrow. Which letter best corresponds to the location where alternative proteins can be produced from the same gene?arrow_forward
- Which describes the role of primase during replication? a. It catalyzes the formation of phosphodiester bonds using NTPs as substrates. \ b. It coordinates synthesis of the leading strand and the lagging strand. c. It functions as a holoenzyme that polymerizes in the 3’→ 5’ direction. d. It uses an exonuclease activity to remove incorrect nucleotides.arrow_forwardIn _____, enzymes cut DNA into fragments, which are separated by size to form a pattern of bands. a. selective breeding b. cloning c. DNA fingerprinting d. protein synthesisarrow_forwardWhich is true of the lagging strand in DNA synthesis? a. It is built elongating towards the replication fork b. It is composed entirely of RNA c. It is built in the 3’ to 5’ direction d. It elongates in a series of segments, rather than continuouslyarrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning