DRAW IT Below are the amino acid sequences(using the single-letter code; see Figure 5.14) of four short segments of the FOXP2 protein from six Speeles: chimpanzce (Q, orangutan (()), gorllla (G), rhesus macaque (R), mouse (M), and human (H). These segments contain all of the amino acid differences helween the FOXP2 proteinsof these species.
Use a highlighter to color anv amino acid that varies among the species. (Color that amino acid in all sequences.
- (a) The C, G, R sequences are identical. Identily which lines correspond to those sequences.
- (b) The O sequence differs from the C, G, R speieces at two amino acids. Underilnethetwodlffcrences inthe H sequence.
- (c) The O sequence diffen from the C, G, R sequences at one amino acid (having V instead of A) and from the H sequence at three amino acids. Identify tho O sequence.
- (d) In the M sequence,circle the amino acid(s) that differ from the C, G, R sequence, and draw a square around those that differ from the H sequence.
- (e) Primates and rodents diverged between 60 and IO0 million years ago. and chimpanzees and humans about 6 million years ago. Compare the amino acid differences between the mouse and the C, G, R species with those between the human and the C, G, R species. What can you conclude?
Learn your wayIncludes step-by-step video
Chapter 21 Solutions
CAMPBELL'S BIOLOGY 12E PERUSALL
Additional Science Textbook Solutions
Human Biology: Concepts and Current Issues
Campbell Biology in Focus (2nd Edition)
Campbell Biology: Concepts & Connections (9th Edition)
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Becker's World of the Cell (9th Edition)
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. provide calculationarrow_forwardYou have discovered a novel protein that has a pl = 5.5. To study the functional properties of this new protein your research group has made a mutant that contains two amino acid changes-namely, a surface Phe residue in the normal protein has been replace by His (side chain pk = 6.1), and a surface Gln has been replace by Glu (side chain pk. = 6.0). The pl of the mutant protein is predicted to be: A. Greater than the pl of the normal protein. B. Less than the pl of the normal protein. C. The same as the pl of the normal protein.arrow_forwardIn a folded protein, Glu116 is close in three-dimensional space to Lys224. The pKa of the carboxylic acid functional group in the side chain of glutamic acid is 4.3. The pKa of the amino group in the side chain of lysine is 10.5. How do you think the pKa of the side chain of Glu116 will change in the folded protein? a. The pKa will be > 4.3. b. The pKa will be < 4.3. c. The pKa will not change. Use chemical reasoning to justify your answer.arrow_forward
- A hypothetical protein found in humans, chimpanzees, and orangutans has the following sequences. Underlining indicates amino acid residue differences and dashes indicate a deletion. Humans ATSAAGYDEWEGGKYLIHL--KLQNRGALLELDIGAV ATSAAGWDEWEGGKILIHLDGKLQNRGALLELDIGAV ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV Chimpanzees Orangutans What is the sequence of the protein present in the last common ancestor of humans and chimpanzees? sequence: ATSAAGWDEWEGGKVLIHILDGKLQNRGALIELDIGAV Incorrect Answerarrow_forwardAlthough the Shine-Dalgarno sequences vary considerably in differ- ent genes, they include examples like GAGGGG that could serve as code-in this case, for Glu-Gly. Does this imply that the sequence Glu-Gly cannot ever occur in a protein, lest it be read as a Shine-Dalgarno sequence? Speculate.arrow_forwardA pentapeptide was found to increase the rate of hydrolysis of fats in the adipose tissues to provide fatty acids as sources of energy. The amino acid sequence of this peptide was determined to be: ALA-ARG-LYS-MET-SER Hydrolysis of the three variants of the peptide, and analysis of their amino acid composition revealed the following changes: Variants Amino Acid Replacement Peptide 1 Arg was replaced by Leu Peptide 2 Ala was replaced by Tyr Peptide 3 Arg was replaced by Glu What will be the positions of these variant peptides compared with the normal peptide in an electrophoretic run at pH 7.0?arrow_forwardA segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?arrow_forwardA peptide with 19 amino acid residues was digested with trypsin and generated the following fragments: • GGIR SFLG WAAPK AEEGLR A similar peptide was treated with chymotrypsin and generated the following fragments: • LG AEEGLRW AAPKGGIRSF Elucidate the correct sequence of the peptide.arrow_forwardShown to the right is a cartoon image of ETC Complex I from Y. lipolytica. A group of authors studied this wild type Complex I and also a version where the arginine at position 121 in the chain 3 subunit was mutated to a methionine (R121M). Part of chain 3 subunit contains the peptide sequence SMITH a. Draw the titration curve for the SMITH peptide. Mark all pKa’s and the pI on your curve. For the SMITH peptide at physiological pH, explain what types of interactions you believe the side chains are or are not able to participate in.arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education