LaunchPad for Biology: How Life Works (Six-Months Online)
3rd Edition
ISBN: 9781319305727
Author: Morris, JAMES
Publisher: Macmillan Higher Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.1, Problem 5SAQ
Summary Introduction
The process that involves in the generation of new and unique forms of life is referred to as
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
From the DNA sequence data for the eight species (A through H) shown below, what is the genetic
distance between Species A and Species C?
O 4
5
6
1
O 7
2
3
4
Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT
Species B
ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT
Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT
Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT
Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT
E
Species
Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT
G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT
Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT
5
6
7
Asap
What is meant by term Allelomorphs?
Chapter 21 Solutions
LaunchPad for Biology: How Life Works (Six-Months Online)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Construct the data matrix From the DNA sequence data from the 5 taxa. (Hint: there are three variable nucleotide sites, which are the characters) Map all three characters onto both mypotheses using two Colors (same as in Activity 6). 3 position 111111 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 ATTGCGGCCTGTATG Taxon A Taxon B ATGGCGGGCTGTAAG Taxon C ATTGCGGGCTGTATG Taxon D ATTGCGGGCTGTAAG Taxon E ATGGCGGCCTGTATG 1 Determine the treelength of both hypotheses and fill in 3 the treelength and Justify Text minimum number of changes in the table on the lower right. Then compute the CI for both hypotheses and put a checkmark or X to indicate which one is the most parsimonious and which one is the most accurate. 4 Character/ states Taxon A Use the most accurate phylogeny to infer the origin of the new fungal pathogen Taxon B Hypothesis Treelength Minimum CI Most parsimonious Most accurate Taxon C Taxon D 1 taxon taxon A taxon B taxon C taxon D taxon E Taxon E Minimum 2 origin Florida (new) Mexico China…arrow_forwardSuppose species 1, 2, and 3 are endemic to a group of islands (such as the Galápagos) and are all descended from species 4, an outgroup. We sequence a gene and find ten nucleotide sites that differ among the four species (among many other loci that do not vary). The nucleotide bases at these sites are Species 1: GCTGATGAGT Species 2: ATCAATGAGT Species 3: GTTGCAACGT Species 4: GTCAATGACA Estimate the phylogeny of these taxa by plotting the changes on each of the three possible trees and determine which tree requires the fewest evolutionary changes. (Please answer including what are 3 possible trees.? )arrow_forwardIn keeping with the style of Table 17-1, what would you call organisms that are MM N OO; MM NN OO; MMM NN PP?arrow_forward
- All of the following statements are true about the3-domain classification system EXCEPT:(a) The three domains are Bacteria, Archaea, and Eukarya.(b) Lateral gene transfer has forced us to rethink our do-main model from a “tree of life” to a “shrub of life.”(c) Domains are higher than the category of kingdoms.(d) Compared to Bacteria, Archaea inhabit the same en-virons and have the same amount of peptidoglycan intheir cell walls.(e) All of the above are true.arrow_forwardExplain the following phrase: Degrees of molecular similarity correlate to degrees of species relatedness.arrow_forwardA researcher studying two species (species 1 and species 2) sequences a short stretch of eight codons from the same gene, gene B, in each and compares them. Species 1 and species 2 had a most recent common ancestor 50 million years ago. Species 1: ATC GGG CGG GAC TTA CTA TAT GCC Species 2: ATT GGG CGG GAC TTG CTA TAT GCC Given the differences between the sequences of the two species' genes shown here, what evolutionary force can you predict is most likely in operation on gene B?arrow_forward
- Which of these ten specimens are heterotrophic? Explain why or why not?arrow_forwardWhat are the classification categories from broadest to most specific? What is a species? What are the 3 domains? What are the 4 kingdoms in the domain Eukarya and give an example of e What are the classification categories from broadest to most specific? What is a species? What are the 3 domains? What are the 4 kingdoms in the domain Eukarya and give an example of each.? W What are the classification categories from broadest to most specific? What is a species? What are the 3 domains? What are the 4 kingdoms in the domain Eukarya and give an example of each.? What is a binomial name? What is the proper form to write a binomial name? What are the 5 characteristics of living thing? What is the basic unit of organization of all living things? What is the biosphere? What is an ecosystem? hat is a binomial name? What is the proper form to write a binomial name? What are the 5 characteristics of living thing? What is the basic unit of organization of all living things? What is the…arrow_forwardVolvox carteri, an volvocine alga, has approximately 2000 somatic cells and only 16 reproductive or germ line cells. The observation that multicellular individuals, like Volvox, have a much smaller subset of germ line cells compared to somatic cells appears to be general rule. Which of the following is the best evolutionary explanation for why this is the case? A) Organisms can biologically only contain a small number of germ line cells as they are always larger than somatic cells. B) Multicellular individuals with a germ line vs. somatic cell line differentiation only evolved a single time, thus all members of this lineage share the same scheme of more soma cells with a much smaller subset of germ line cells. C) Having a smaller subset of reproductive cells helps reduce the likelihood of cheating from evolving, which in turns prevents the collapse of the multicellular individual system. D) None of the above.arrow_forward
- How do the morphological, biological, and phylogenetic speciesconcepts differ? (Please mention answer and explanation section separately. mention atleast 3-4 points of difference)arrow_forwardUnder the endosymbiotic theory for the origin of the eukaryotic cell. The ancestor of mitochondria and chloroplasts original became part of mutualism with a larger host cell. Which of the following best explains this mutualism? A) The mitochondria and chloroplasts provided specialized reproduction as part of the proto-germ line while the larger host cell provided energy for growth and reproduction. B) The mitochondria and chloroplasts provided gene products that could be used by the larger host cell for improved parasitization. C) The mitochondria and chloroplasts provided molecular energy in return for protection by the larger host cell. D) The mitochondria and chloroplasts produce toxins that the larger cell utilized to defend itself from other cells mutually increasing the defense of all those involved.arrow_forwardImagine you are studying two eukaryotic species. The genome of Species A is 100 Mb in size. The genome of Species B is 500 Mb in size. Based only on this information, which of the following statements are accurate? Species B is a more complex organism than Species A. None of the other statements can be made based solely on the information in the question. Species B has more genes than Species A. Species B has more chromosomes, more genes, and is more complex than Species A. Species B has more chromosomes than Species A.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License