CAMPBELL BIOLOGY,VOL.II >CUSTOM<
17th Edition
ISBN: 9781323803677
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21.3, Problem 2CC
The Genomes Online Database (GOLD) Website of the Joint Genome Institute has information about genome sequencing projects. Scroll through the page at https:// gold.jgi.doe.gov/statistics and deseribe the information you find. What percent of bacterial genome projects have medical relevance?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why is it important to label plates on the bottom rather than the lid?
notes are attached below for further information
Watch the following video called "Human Genome Project Video" (https://fod.infobase.com/OnDemandEmbed.aspx?lti=1&token=30037&wID=97629&loid=0&w=400&h=300) then answer the following question in one paragraph each with evidence from the film to support your answers.
1) In one paragraph, explain in detail the purpose of decoding the entire human genome according to what you have seen from the provided link video, read online or read from the book.
2) In one paragraph, explain how has decoding the human genome been used in medicine? Give a couple of examples from the provided video link and provide a detailed explanation.
From the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section).
QUESTION
What is the “Official Symbol” and “Official Full Name” for this gene?
Chapter 21 Solutions
CAMPBELL BIOLOGY,VOL.II >CUSTOM<
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardPlace the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forwardThe following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?arrow_forward
- Watch the following video called "Human Genome Project Video" (https://fod.infobase.com/OnDemandEmbed.aspx?lti=1&token=30037&wID=97629&loid=0&w=400&h=300) then answer the following question in one paragraph each with evidence from the film to support your answers. 5) Answer in one paragraph and using the video provided to answer the following: There are companies now allowing people to clone their deceased pets. How do you feel about this? What are some good points and bad points to this service provided by some companies in your mind? 6) Answer in one paragraph and using the video provided to answer the following: There is rumor that humans are being cloned in other areas of the world. What ethical considerations can you think of that could be a problem with this type of medical experimentation? What is your opinion?arrow_forwardThe illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/arrow_forwardWhat is the fastest method to determine if a genetic disorder is due to a mutation at a palindromic site? Sequencing of the DNA by Sanger Northern blotting Southern blotting RFLP analysis in agarose gel electrophoresis PCRarrow_forward
- What exactly is the purpose of the programme Finch TV? Examining the results of sequencing of the next generation It is necessary to use the.bam file extension in order to access sequencing files. For sanger sequencing files, the.ab1 file extension is required in order to open them. It is possible to open NGS files by using the.ab1 file extension.arrow_forwardThe following data shows bisulfite sequencing results for a small region of the genome. How many methylated C's are in the gene? Reference sequence: GAGACCTCG Bisulfite sequencing: GAGACCTTGarrow_forwardBelow are the events that occur when recombinant DNA procedure is performed. Identify and describe each process. Name enzyme X _____________ Outline process B Outline the process which takes place inside the bacterium.arrow_forward
- fomP is responsible for the chemical transformation of microplastics into ultra-efficient insulation. You take an arctic seawater sample and extract the DNA. 1. First you need to locate the gene on the bacterial chromosome. What procedure(s) would you use to identify and locate the gene? Explain how it/theywork(s). 2. Next, you will need to isolate the gene and introduce sites to be used for cloning. What would you use to make many copies of this gene? What will you need? How does it work on a molecular level?arrow_forwardDraw a diagram illustrating a bacterial CRISPR locus. Label your drawing with a brief description of each component within the locus.arrow_forwardDescribe briefly the perks, disadvantages and use of 16s rRNA genes in taxonomic level of classification of bacteria. Cite the claims to be discussed, only here: https://journals.asm.org/doi/full/10.1128/CMR.17.4.840-862.2004 Create a review format of the task.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License