ANATOMY AND PHYSIOLOGY
17th Edition
ISBN: 9781630180928
Author: OpenStax
Publisher: OPENSTAX C
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 3ILQ
Watch this video (http://openstaxcollege.org/l/DNArep) to learn about
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Describe DNA replication
explain DNA Replication
Explain steps in DNA replication with words and pictures
Chapter 3 Solutions
ANATOMY AND PHYSIOLOGY
Ch. 3 - Visit this link...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Visit this link...Ch. 3 - Because they are embedded within the membrane, ion...Ch. 3 - The diffusion of substances within a solution...Ch. 3 - Ion pumps and phagocytosis are both examples of...Ch. 3 - Choose the answer that best completes the...Ch. 3 - Choose the term that best completes the following...
Ch. 3 - The rough ER has its name due to what associated...Ch. 3 - Which of the following is a function of the rough...Ch. 3 - Which of the following is a feature common to all...Ch. 3 - Which of the following organelles produces large...Ch. 3 - The nucleus and mitochondria share which of the...Ch. 3 - Which of the following structures could be found...Ch. 3 - Which of the following sequences on a DNA molecule...Ch. 3 - Place the following structures in order from least...Ch. 3 - Which of the following is part of the elongation...Ch. 3 - Which of the following is not a difference between...Ch. 3 - Transcription and translation take place in the...Ch. 3 - How many letters of an RNA molecule, in sequence,...Ch. 3 - Which of the following is not made out of RNA? the...Ch. 3 - Which of the following phases is characterized by...Ch. 3 - A mutation in the gene for a cyclin protein might...Ch. 3 - What is a primary function of tumor suppressor...Ch. 3 - Arrange the following terms in order of increasing...Ch. 3 - Which type of stem cell gives rise to red and...Ch. 3 - What multipotent stem cells from children...Ch. 3 - What materials can easily diffuse through the...Ch. 3 - Why is receptor-mediated endocytosis said to be...Ch. 3 - What do osmosis, diffusion, filtration, and the...Ch. 3 - Explain why the structure of the ER, mitochondria,...Ch. 3 - Compare and contrast lysosomes with peroxisomes:...Ch. 3 - Explain in your own words why DNA replication is...Ch. 3 - Why is it important that DNA replication take...Ch. 3 - Briefly explain the similarities between...Ch. 3 - Contrast transcription and translation. Name at...Ch. 3 - What would happen if anaphase proceeded even...Ch. 3 - What are cyclins and cyclin-dependent kinases, and...Ch. 3 - Explain how a transcription factor ultimately...Ch. 3 - Which of the following structures could be found...
Additional Science Textbook Solutions
Find more solutions based on key concepts
What is the ideal banking angle for a gentle turn of 1.20 km radius on a highway with a 105 km/h speed limit (a...
College Physics
Compare and contrast aerobic respiration, anaerobic respiration, and fermentation.
Microbiology with Diseases by Body System (5th Edition)
1. Which parts of the skeleton belong to the appendicular skeleton? Which belong to the axial skeleton?
Human Anatomy & Physiology (2nd Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
In Drosophila, Dichaete (D) is a mutation on chromosome III with a dominant effect on wing shape. It is lethal ...
Concepts of Genetics (11th Edition)
Body, Heal Thyself The precision of mitotic cell division is essential for repairing damaged tissues like those...
Biology: Life on Earth with Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’arrow_forwardThe structure of DNA requires both hydrogen bonds and phosphodiester bonds. Describe the location of the hydrogen bonds and explain how a DNA strand uses hydrogen bonds. Explain the connection between hydrogen bonds and DNA replication. Describe the location of the phosphodiester bonds and explain how a DNA strand uses phosphodiester bonds.arrow_forwardIllustrate some steps involved in DNA replication :Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’ What would be the bases in the complementary strand? Label the 3’ and the 5’ ends. Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands. Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate…arrow_forward
- Label a diagram of DNA replication, identifying the location of each step in the process.arrow_forwardDescribe the purpose of DNA replication.arrow_forwardIn the process of DNA replication, there are four important enzymes. Construct a table, provide what the four enzymes are, and explain how they function in DNA replication.arrow_forward
- Why are enzymes needed in the process of the DNA replicationarrow_forwardDNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1.arrow_forwardname the enzymes responsible for DNA replication and transcription. comment on their similarities and differencesarrow_forward
- Outline and describe the process of DNA replication.arrow_forwardWhich describes the correct sequence of steps of protein synthesis? Group of answer choices The DNA strand unzips and a complementary mRNA strand is copied. The mRNA travels to the ribosome where tRNA "reads" it and brings the appropriate amino acids indicated by the mRNA strand nucleotide bases. The string of amino acids creates a peptide chain. Multiple peptide chains create a protein. The RNA strand travels to the ribosome where the DNA strand "reads" it and brings the appropriate amino acids indicated by the RNA strand nucleotide bases. The string of amino acids creates a peptide chain. Multiple peptide chains create a protein. The RNA strand unzips and a complementary mRNA strand is copied. The mRNA travels to the ribosome where tRNA "reads" it and brings the appropriate amino acids indicated by the mRNA strand nucleotide bases. The string of amino acids creates a peptide chain. Multiple peptide chains create a protein. The DNA strand travels to the ribosome, where tRNA…arrow_forwardWhen DNA replicates, each resulting DNA molecule retains half of the original DNA strand. Because of this, the process is described asarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781938168130/9781938168130_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY