BIOLOGY
5th Edition
ISBN: 9781264104680
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 33, Problem 9TY
Summary Introduction
Introduction: An embryo subdivides into multiple segments due to the presence of segmentation genes. Hox genes then cause each segment to develop its own unique characteristics. The evolution of body forms and novel structures in arthropods and vertebrates have occurred due to the shift in the expression patterns of Hox genes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following statements about genes is incorrect?
Select one:
O a. During fertilization, both the sperm and the ovum contribute genes to the resulting fertilized egg.
b. Genetic differences can result from changes in the DNA called mutations.
O c. Genes correspond to segments of DNA.
d. Under normal circumstances, each chromosome contains precisely one gene.
e. Many genes contain the information needed for cells to synthesize enzymes and other proteins.
Which of the following statements about Tbx5 is true?
a. Tbx5, Tbx4, and AmphiTbx4/5 have very similar coding regions.
b. Tbx5 is involved in tail development in vertebrates.
c. Tbx5, Tbx4, and AmphiTbx4/5 have very similar regulatory regions.
d. Tbx5 initiates hindlimb development.
An organism has a relatively large number of Hox genes in its genome. Which of the following is true
of this organism?
Select one:
А.
Its Hox genes cooperate to bring about sexual maturity at the proper stage of development.
В.
Most of its Hox genes owe their existence to gene fusion events.
С.
The organism must have multiple paired appendages along the length of its body.
D.
These genes are fundamental, and are expressed in all cells of the organism.
E.
The organism has the genetic potential to have a relatively complex anatomy.
Chapter 33 Solutions
BIOLOGY
Ch. 33.2 - Core Skill: Connections Look back to Figure 25.8....Ch. 33.2 - Prob. 2CSCh. 33.3 - Prob. 1CSCh. 33.3 - Prob. 1EQCh. 33.3 - Prob. 2EQCh. 33.3 - Prob. 3EQCh. 33 - Prob. 1TYCh. 33 - Prob. 2TYCh. 33 - Prob. 3TYCh. 33 - In triploblastic animals, the inner lining of the...
Ch. 33 - Prob. 5TYCh. 33 - Prob. 6TYCh. 33 - Prob. 7TYCh. 33 - Naturally occurring identical twins are possible...Ch. 33 - Prob. 9TYCh. 33 - A major finding of recent molecular studies is...Ch. 33 - Fierce debate centers on whether ctenophores or...Ch. 33 - Why was the evolution of a coelom important?Ch. 33 - Prob. 3CQCh. 33 - Discuss the many ways that animals can affect...Ch. 33 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1a) Why is it possible for you to study the eye colour gene by extracting cheek cells? a. Because the nucleus of every cell in the human body contains the same genetic information. b. Because the cheek cells are located near the cells of the eye and so they are able to exchange DNA. c. Because all genes in the human body are expressed at all times so it is easy to study them. d. All of the above are possible explanations. 1b) What is the purpose of heating the sample to 75°C following addition of the 0.2M NaOH solution? a. To denature the histone proteins that are keeping the DNA tightly coiled. b. To ensure that all the DNA is removed from the swab in preparation for PCR. c. To breakdown the cheek cell membrane to release the DNA from the cell. d. It breaks down the circular DNA down into linear fragments so that they will be easier to visualize.iarrow_forwardAt birth a child has got blue eyes, but now his/her eyes turn brown. Which of the following statements would best explain the observed phenomena? A. The child does not have brown pigment at birth B. Eye’s colour at birth is affected by mother’s gene C. Gene repressor for brown pigment produced is not yet active D. Gene activatior for brown pigment production is not yet active at birth E. All of the above statements are falsearrow_forwardIf a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a loss-of-function or a gain-offunction mutation? Explain your answer. A. An abdominal segment has antennae attached to it. B. The most anterior abdominal segment resembles the most posterior thoracic segment. C. The most anterior thoracic segment resembles the most posterior abdominal segment.arrow_forward
- Gene expression is a term that relates to Select one: A. DNA replication. B. the flow of genetic information from DNA to proteins. C. how genes are passed from parent to offspring. D. the unique set of genes in an individual.arrow_forwardEpigenesis relating to genetics refers to which of the following A. Genetic information is limited to what we inherit only from our biological parents. B. Genes are not influenced by environmental factors. C. Genes we inherit are fully expressed at birth. D. Genes are turned on or off as needed, by the developing body or environmental triggers, across the life-spanarrow_forwardA.) DNA encodes for the cell genome and is therefore a permanent copy to have a functioning cell. B.)Different changes to the structure of messenger RNA can cause mutations and genomic instability which could lead to abnormal cells in the body. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrectarrow_forward
- Insect wings are coded for by the same gene that creates... A. internal air branches (trachea) B. Their cuticle C. their antennae D. parts of crustacean appendages, like legsarrow_forwardOf those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardPlease give a detailed answer on the following questions below using Campbell Biology Textbook: 1. You hope to study a gene that codes for a neurotransmitter protein produced in human brain cells. You know the amino acid sequence of the protein. Explain how you might... a. ...identify what genes are expressed in a specific type of brain cell. Why do(es) the technique(s) you chose make sense to use? b. ...identify (and isolate) the neurotransmitter gene. c. ...produce multiple copies of the gene for study. d. ...produce large quantities of the neurotransmitter for evaluation as a potential medication.arrow_forward
- a. Which gene is mutated in individuals with sickle-cell anemia? b. What are the major symptoms of this disorder? c. What was the first published scientific description of sickle-cell anemia? d. Describe two other features of this disorder that you learned from the OMIM database and state where in the database you found this informationarrow_forwardWhich of the following is true about the enzyme telomerase? A. It is found only in adult cells. B. It is responsible for telomere shortening. C. It can re-establish telomere length. D. It may speed up the aging process. E. It is expressed at low levels in cancer cells.arrow_forwardWhich of the following statements does NOT describe an environmental influence on the expression of a gene? Select one: a. Siamese cats have darkened paws, nose, and tip of tail due to a gene that allows their skin and fur to darken in the parts of their bodies that need to retain more heat, their extremities. b. More than a single gene is involved in the expression of human height, weight, and skin colour. c. Exposure to sunlight increases melanin production in human skin. d. Colder incubation temperatures of gecko eggs yield more females and warmer temperatures yield more males.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY