GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
5th Edition
ISBN: 9781260149364
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 1CM
Summary Introduction
To create:
A concept map illustrating the relationships among key terms such as genus, species, serotype, domain, Borrelia burgdorferi and spirochete.
Concept introduction:
The most common type of the prokaryotes is bacteria. They are found in every existing environment on the earth and although they are small in size, their biomass exceeds of animals and plants combined. The cell wall of bacteria is made up of peptidoglycan layer, they lack membrane-bound organelles and exhibit an asexual mode of reproduction.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Briefly discuss what is the link between food, Listeria monocytogenes and phages
Kindly check the attached image
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC
GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Create a phylogenetic tree for the following organisms:
Glomus
Spirogyra
Entamoeba
Radiolarian
Shimeji mushroom
water mold
slime mold
Aspergillus
Chapter 4 Solutions
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
Ch. 4.1 - List the structures all bacteria possess.Ch. 4.1 - Identify at least four structures that some, but...Ch. 4.1 - Prob. 3AYPCh. 4.1 - Prob. 4AYPCh. 4.1 - Provide at least four terms to describe bacterial...Ch. 4.2 - Describe the structure and function of five...Ch. 4.2 - Prob. 7AYPCh. 4.3 - Prob. 8AYPCh. 4.3 - Prob. 9AYPCh. 4.3 - Prob. 10AYP
Ch. 4.4 - Prob. 11AYPCh. 4.4 - Prob. 12AYPCh. 4.5 - List some differences between archaea and...Ch. 4.6 - Differentiate between Bergeys Manual of Systematic...Ch. 4.6 - Prob. 15AYPCh. 4.6 - Define a species in terms of bacteria.Ch. 4 - Which of the following is not found in all...Ch. 4 - Pili are tubular shafts in ____ bacteria that...Ch. 4 - Prob. 3MCQCh. 4 - Which of the following is a primary bacterial cell...Ch. 4 - Which of the following is present in both...Ch. 4 - Darkly stained granules are concentrated crystals...Ch. 4 - Bacterial endospores usually function in a....Ch. 4 - A bacterial arrangement in packets of eight cells...Ch. 4 - Prob. 9MCQCh. 4 - Prob. 10MCQCh. 4 - Prob. 11TFCh. 4 - A research microbiologist looking at evolutionary...Ch. 4 - Nanobes may or may not actually be bacteria.Ch. 4 - Both bacteria and archaea used to be known as...Ch. 4 - Prob. 15TFCh. 4 - Define the term ubiquitous and explain whether...Ch. 4 - Quorum sensing is a process used by many bacteria...Ch. 4 - Based upon your knowledge of cell wall structure,...Ch. 4 - Provide evidence in support of or refuting the...Ch. 4 - a.Describe the characteristics of an...Ch. 4 - Prob. 1VCCh. 4 - From chapter 1, figure 1.14. Study this figure....Ch. 4 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- fungus Aspergillus sydowii Write a short summary (4 paragraphs) about fungus Aspergillus sydowii using all four resources.please add the citations within the text. 1) Presence of Aspergillus sydowii, a pathogen of gorgonian sea fans in the marine sponge Spongia obscura N Ein-Gil, M Ilan, S Carmeli, GW Smith, JR Pawlik… - The ISME …, 2009 2) Purification and Biochemical Characterization of Two Xylanases from Aspergillus sydowii SBS 45 SG Nair, R Sindhu, S Shashidhar - Applied biochemistry and …, 2008 3) Biotechnological potential of a novel tannase-acyl hydrolase from Aspergillus sydowii using waste coir residue: Aqueous two-phase system and chromatographic … KKSA Albuquerque, WWC Albuquerque… - Biocatalysis and …, 2020 4) Aspergillus sydowii: Genome Analysis and Characterization of Two Heterologous Expressed, Non-redundant Xylanases SC Brandt, B Ellinger, T Van Nguyen… - Frontiers in …, 2020arrow_forwardKarelina Bologicel Supply Company Give the DOMAIN for these organismsarrow_forwardThe following table depicts characteristics of five prokaryotic species (1-5). Use the information in the table to answer the following question. Species 1 Species 5 None Trait Plasmid Gram Staining Results Nutritional Mode Species 2 None Species 3 R Species 4 IF Positive Positive Negative Negative Negative Chemohetero- Chemoauto- troph Chemohetero- Chemohetero- Photoauto- troph Anaerobic troph troph troph Aerobic Specialized methanotroph Metabolic (obtains carbon Pathways and energy from methane) Anaerobic methanogen Anaerobic alcoholic fermentation Anaerobic lactic nitrogen fixation acid fermentation and aerobic photosystems I and II Other Features All of the species shown have a cell wall that consists partly of an outer membrane of lipopolysaccharide EXCEPT Internal membranes Fimbriae Flagellum Pili Thylakoids species 1 only species 2 only species 3, 4, and 5 species 1 and 2 only 0 O 0 0arrow_forward
- Give the correct scientific name of the following: It is is the slides, textbook, and videos I gave you. This is a give away question if you have learned the system. Give a description of each species, including its domain and kingdom. kainops invius bacillus anthracisraphus cucullatusmilnesium tardigradumarchaeopteryx lithographicaarrow_forwardAnimal Taxonomy (Protista) Comparison Intermediate Euglena Trypanosoma Plasmodium Paramecium Amoeba host Definite host Habitat Disease Vector Infective stage locomotion Feeding Reproduction Major characteristics Life cyclearrow_forwardWhich interpretation(s) of the comparison between this host and parasite phylogenetic tree from Moran & Bauman 1994 paper could be correct? bacteria Buchnera aphidicola Ruminobacter amylophilus Proteus vulgaris Escherichia coli Schlectendalia chinensis Melaphis rhois -- Pemphigus betae Mindarus victoriae--- Chaitophorus viminalis Diuraphis noxia Acyrthosiphon pisum Uroleucon sonchi Myzus persicae Rhopalosiphum padi Rhopalosiphum maidis- Schizaphis graminum---- aphids 48-70 My ago 80-120 My ago 30-80 My ago 80-160 My ago origin of endosymbiotic association Fig. 1. Phylogeny of the primary symbionts of aphids (Buchnera aphidicola complex) and phylogeny of the corresponding aphid hosts. The bacterial phylogeny is based on 16S rDNA sequences18.19; the aphid phylogeny is based on morphology21, Dashed lines indicate associations. Taxa within Buchnera are represented by names of their aphid hosts. The concordance of the two trees supports synchronous parallel cladogenesis of aphids and…arrow_forward
- How was Brocadia anammoxidan named? What or who was it named after? (Organisms are often named for where they were found, unique morphological or metabolic features, name of the person who discovered it, etc. Attempt both genus and species name. For example, if my organism was Xanthomonas oryzae, I would Google “Xanthomonas word origin.” and “oryzae word origin.” Often a word origin is Greek or Latin, so Google your word followed by “Greek” or “Latin”)arrow_forwardGive the rank of the following taxa. 1. Gasteromycetes 2. Mangifera 3. Homininae 4. Eubacteria 5. Ganoderminae 6. Cyperaceae 7. Bangiophycidae 8. Pongidae 9. Basidiomycetidae 10. Leucophiniarrow_forwardWhat possible explanations have been proposed for the origins of H. luzonensis? In your own words, describe the evidence that supports these explanations. (Minimum of 2 complete sentences.)arrow_forward
- The phylum Protista has often been referred to as a junk drawer of classification. Explain what is meant by this term.arrow_forwardPlease answer asap and type your answer and do not copy from anywhere please ? List the dimorphic fungi by genus and species and describe the growth rate of the mold form and yeast conversions: a. Histoplasma capsulatum b. Sporothrix schenckii c. Coccidioides immitis d. Paracoccidioides brasiliensis e. Blastomyces dermatitidisarrow_forwardShigella Sonnei A short paragraph on the habitat of the organism. A short paragraph on the special characteristics of the organism. And a short paragraph on the clinical significance of the organism. please attach references!arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Fossil: The Language & History of Paleontology; Author: Alliterative;https://www.youtube.com/watch?v=x9yNwRBlKtU;License: Standard youtube license