![GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD](https://www.bartleby.com/isbn_cover_images/9781260149364/9781260149364_smallCoverImage.jpg)
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
5th Edition
ISBN: 9781260149364
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5, Problem 1CM
Using the words that follow, please create a concept map illustrating the relationships among these key terms from chapter 5.
Golgi apparatus
chloroplasts
cytoplasm
endospore
ribosomes
flagella
nucleolus
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
If I have to compare this organelle to the offices in the city, it is the Cotabato Light Company for its ability to supply electricity to the entire city.*
Cytoplasm
Mitochondria
Endoplasmic Reticulum
Lysosome
Find and label the cell wall, cytoplasm, vacuole bounded by tonoplast, nucleus (if visible) of this plasmolyzed cell.
Label this figure of a cell. What is the function of each organelle? Is the cell prokaryotic or eukaryotic? How do you know?
DO NOT COPY AND PASTE PLEASE!
Chapter 5 Solutions
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
Ch. 5.1 - Relate bacterial, archaeal, and eukaryotic cells...Ch. 5.1 - List the types of eukaryotic microorganisms and...Ch. 5.2 - Differentiate between cilia and flagella in...Ch. 5.2 - Prob. 4AYPCh. 5.2 - Prob. 5AYPCh. 5.2 - Prob. 6AYPCh. 5.3 - Describe the main structural components of a...Ch. 5.3 - Diagram how the nucleus, endoplasmic reticulum,...Ch. 5.3 - Explain the function of the mitochondrion.Ch. 5.3 - Prob. 10AYP
Ch. 5.3 - Prob. 11AYPCh. 5.3 - Prob. 12AYPCh. 5.4 - Prob. 13AYPCh. 5.4 - Differentiate among the terms heterotroph,...Ch. 5.4 - Prob. 15AYPCh. 5.4 - Prob. 16AYPCh. 5.4 - Prob. 17AYPCh. 5.5 - Prob. 18AYPCh. 5.5 - Prob. 19AYPCh. 5.5 - Prob. 20AYPCh. 5.5 - Prob. 21AYPCh. 5.6 - Prob. 22AYPCh. 5.6 - Summarize the stages of a typical helminth life...Ch. 5 - Both flagella and cilia are found primarily in a....Ch. 5 - Features of the nuclear envelope include a....Ch. 5 - The cell wall is found in which eukaryotes? a....Ch. 5 - Prob. 4MCQCh. 5 - Algae generally contain some type of a. spore. b....Ch. 5 - Almost all protozoa have a a. locomotor organelle....Ch. 5 - All mature sporozoa are a. parasitic. b....Ch. 5 - Parasitic helminths reproduce with a. spores. b....Ch. 5 - Mitochondria likely originated from a. archaea. b....Ch. 5 - Most helminth infections a. are localized to one...Ch. 5 - Prob. 11TFCh. 5 - Prob. 12TFCh. 5 - Prob. 13TFCh. 5 - Prob. 14TFCh. 5 - Prob. 15TFCh. 5 - Summarize the endosymbiotic theory and explain how...Ch. 5 - Compare and contrast the structure and function of...Ch. 5 - Write a paragraph illustrating the life of a...Ch. 5 - Prob. 4CTQCh. 5 - Prob. 5CTQCh. 5 - Prob. 1VCCh. 5 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Construct your own concept map using the following words as the concepts. Supply the linking words between each pair of concepts. (Make one concept map for prokaryotic microbes and another for eukaryotic microbes) PROKARYOTIC MICROBES: genus species serotype domain Borrelia burgdorferi spirochete EUKARYOTIC MICROBES: Golgi apparatus chloroplasts cytoplasm endospore ribosomes flagella nucleolusarrow_forwardTry to identify the cell organelles labeled in these artist's renderings of transmission electron micrographsarrow_forwardEukaryotic cells are almost always larger than prokaryotic cell. What structure might allow for their larger size.arrow_forward
- not necessary to fill table you can provide answer in paragraph form too. Complete a table that lists the organelles of a eukaryotic cell. Provide a column to identify the molecular structure of each organelle and a column for the function of each organelle. Organelle Molecular Structure Function Cell membrane Nucleus Endoplasmic reticulum Golgi Lysosome Ribosome mitochondriaarrow_forward2. Write PRESENT if the organelle in column 1 can be found in prokaryotes (column 2) and eukaryotes(column 3), otherwise write ABSENT. ORGANELLE PROKARYOTE EUKARYOTE Nucleus Cell membrane/plasma membrane Cytoplasm Flagella Mitochondria Endoplasmic reticulum Ribosome Vacuole Chloroplastsarrow_forwardWhat features of mitochondria are similar to bacteria? Select all that apply. Independent movement Membrane-bound ribosomes Circular DNA similar to plasmids Cellular machinery for photosynthesisarrow_forward
- Some members of the Chlorophyta are unicellular, such as Chlamydomonas, shown here at 1000x. Make a sketch of this organism and using your Photo Atlas or online resources, label eyespot, chloroplast, flagellum, cell wall, nucleus. Upload your sketch here. MacBook Pro SCarrow_forwardSome members of the Chlorophyta are unicellular, such as Chlamydomonas, shown here at 1000x. Make a sketch of this organism and using your Photo Atlas or online resources, label eyespot, chloroplast, flagellum, cell wall, nucleus. Upload your sketch here. MacBook Pro # $ % & 2 3 4 6arrow_forwardMatch the organelle with its function. Definitions are in screenshot. 1. Nucleus 2. Endoplasmic reticulum 3. Golgi apparatus 4. Lysosomes 5. Vacuole 6. Peroxisomearrow_forward
- All of the following are part of a prokaryotic cell except cell membrane ribosome Golgi apparatus chromosomearrow_forwardFor the following questions referring to cell types and structures, please use the image below for reference. Questions that refer to Cell #1, Cell #2, or Cell #3 are indicating that you should look at the following image to help answer the question. Cell #1 Cell #2 Cell #3 Cell membrane Nucleus - Nucleus DNA Cell Wall Cell Wall Mitochondrion : Cll Mitochondrion membrane Cll Chloroplast membranearrow_forwardFrom what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to discover what the genus and species is and read the description of the first organism that is listed. mitochondrion chloroplast ribosome nucleusarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY