GENETICS(LL)-W/CONNECT >CUSTOM<
6th Edition
ISBN: 9781260571561
Author: HARTWELL
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 35P
Figure 6.31shows four potential outcomes of site-specific recombination that depend on the relative arrangement of the target sites for the recombinase enzyme. Could homologous recombination (in the absence of specific target sites and recombinase) also cause all of the same kinds of outcomes? If so, what is so different about how geneticists would use homologous recombination and site-specific recombination?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Two pathways, homologous recombination and nonhomologous end joining (NHEJ), can repair double-strandbreaks in DNA. If homologous recombination is an errorfree pathway whereas NHEJ is not always error free, whyis NHEJ used most of the time in eukaryotes?
Is homologous recombination an example of mutation? Explain.
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro.
Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction.
W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’
X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’
Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’
Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’
Chapter 6 Solutions
GENETICS(LL)-W/CONNECT >CUSTOM<
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If homologous and site-specific recombination could not occur,what would be the harmful and the beneficial consequences?arrow_forwardEukaryotic cells can repair DNA through a process called homologous recombination. What type of DNA damage can be fixed through homologous recombination?arrow_forwardCompare and contrast conjugation, transduction, and transformation. Which processes, if any, involve homologous recombination and which, if any, do not?arrow_forward
- A person with a rare genetic disease has a sample of her chromosomessubjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes look cytologically normal, the probe does not bind to this person’s chromosomes. How would you explain these results? How would you use this information to positionally clone the gene that is related to this disease?arrow_forwardBased on the attached image, if we are using the Holliday junction model of recombination, where exactly would be the positions where DNA is cut? Would it be to the right because of branch migration?arrow_forwardIn DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Notice that, for the Vicia species, the rate of renaturation is much faster in the first hour and then slows down. What might cause this initial rapid renaturation and the subsequent slowdown?arrow_forward
- An Hfr strain of E. coli that is pro * thr leu * lac was "mated" with an F- strain that is pro thr leu lac. Conjugation was interrupted at 10, 13, 17, and 21 minutes with a kitchen blender, and the % occurrence of donor alleles in F- recombinants was determined at each time point (by replica plating cells on minimal media plates that lacked proline, threonine, leucine, or lactose). The data shown below were obtained. % occurrence pro" % occurrence thr* % occurrence leu* % occurrence lac+ Minutes phenotype phenotype phenotype phenotype 10 6. 13 318 1 20 17 41 11 2 29 21 45 18 10 36 What is the order of these four genes on the bacterial chromosome, starting from the origin? Please write your answer as genes separated by dashes, e.g., thr-leu-lac-pro.arrow_forwardT. Miyake and M. Demerec examined proline-requiring mutations in the bacterium Salmonella typhimurium (). On the basis of complementation testing, they found four proline auxotrophs: proA, proB, proC, and proD. To determine whether proA, proB, proC, and proD loci were located close together on the bacterial chromosome, they conducted a transduction experiment. Bacterial strains that were proC+ and had mutations at proA, proB, or proD were used as donors. The donors were infected with bacteriophages, and progeny phages were allowed to infect recipient bacteria with genotype proC− proA+ proB+ proD+. The recipient bacteria werethen plated on a selective medium that allowed only proC+ bacteria to grow. After this, the proC+ transductants were plated on selective media to reveal their genotypes at the other three pro loci. The following results were obtained: Q.Why are there no proC− genotypes among the transductants?arrow_forwardT. Miyake and M. Demerec examined proline-requiring mutations in the bacterium Salmonella typhimurium (). On the basis of complementation testing, they found four proline auxotrophs: proA, proB, proC, and proD. To determine whether proA, proB, proC, and proD loci were located close together on the bacterial chromosome, they conducted a transduction experiment. Bacterial strains that were proC+ and had mutations at proA, proB, or proD were used as donors. The donors were infected with bacteriophages, and progeny phages were allowed to infect recipient bacteria with genotype proC− proA+ proB+ proD+. The recipient bacteria werethen plated on a selective medium that allowed only proC+ bacteria to grow. After this, the proC+ transductants were plated on selective media to reveal their genotypes at the other three pro loci. The following results were obtained: Q.Is there evidence that proA, proB, and proD are located close to proC? Explain your answer.arrow_forward
- What characteristic specifically defines a High Frequency Recombination (HFr) cell line?arrow_forwardT. Miyake and M. Demerec examined proline-requiring mutations in the bacterium Salmonella typhimurium (). On the basis of complementation testing, they found four proline auxotrophs: proA, proB, proC, and proD. To determine whether proA, proB, proC, and proD loci were located close together on the bacterial chromosome, they conducted a transduction experiment. Bacterial strains that were proC+ and had mutations at proA, proB, or proD were used as donors. The donors were infected with bacteriophages, and progeny phages were allowed to infect recipient bacteria with genotype proC− proA+ proB+ proD+. The recipient bacteria werethen plated on a selective medium that allowed only proC+ bacteria to grow. After this, the proC+ transductants were plated on selective media to reveal their genotypes at the other three pro loci. The following results were obtained: Q.Which genotypes represent single transductants and which represent cotransductants?arrow_forwardAn Hfr strain that is hisE + and pheA + was conjugated to a strain that is hisE − and pheA −. The conjugation was interrupted at different times, and the percentage of recombinants for each gene was determined by streaking on media that lacked either histidine or phenylalanine. The following results were obtained: A. Determine the map distance (in minutes) between these twogenes.B. In a previous experiment, it was found that hisE is 4 minutesaway from pabB and that PheA is 17 minutes from pabB. Drawa genetic map showing the locations of all three genes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License