Microbiology with Diseases by Body System Plus Mastering Microbiology with Pearson eText -- Access Card Package (5th Edition)
5th Edition
ISBN: 9780134452333
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 19MC
Summary Introduction
Introduction:
Okazaki fragments are the newly-formed DNA template. They are short and are formed on the lagging strand of the DNA during the replication process. They are complementary to the leading strand of the DNA, which together forms the short double-stranded DNA segments.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Addition or deletion of bases causes which kind of mutation?
Select one:
a.
Frameshift mutation
b.
Transversion
c.
Transition
d.
Transcription
Within the Central Dogma, what is the primary function of DNA?
a.
make proteins
b.
preserve nuclear integrity
c.
maintain the genetic information
d.
keep a boundary between RNA and Protein
How do we call the type of point mutation in which an A->U change occurs in the codon for the sixth amino acid in hemoglobin chain b? a) Inversion b) Transversion c) Transition d) Transamination
Chapter 7 Solutions
Microbiology with Diseases by Body System Plus Mastering Microbiology with Pearson eText -- Access Card Package (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertionarrow_forwardThe original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.arrow_forwardSuccessful bacterial DNA replication does NOT … please explain the answer choice a.ligate DNA nicks b.use a bidirectional fork c.prime new synthesis using DNA primers d.have SSB (single strand binding protein) stabilize single stranded DNAarrow_forward
- Following transcription, the RNA has a complementary sequence of which of the following?Question 9 options: A) regulatory sequences B) termination sequences in the coding strand of DNA C) the template strand of DNA D) none of the answers are correctarrow_forwarda mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only) A. frameshift mutation B. silent mutation C. nonsense mutation D. missense mutationarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new strands in both direction d. seal gaps in the sugar-phosphate backbone e. catalyze carbon bondingarrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardIn DNA replication, the role of topoisomerase is to Question 11 options: a) "unzip" the double stranded DNA in front of DNA polymerase. b) maintain the single stranded DNA. c) supercoil the DNA after the replication fork has passed. d) relieve supercoil tension in the DNA in front of the replication fork.arrow_forward
- Spontaneous mutations can arise from a. all answers are correct b. DNA polymerase inserts an incorrect nucleotide c. a loop occurs during replication d. a base gets damagedarrow_forwardhow does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine- Dalgarno sequence C. the kozak sequence D. thee 5'caparrow_forwardTranscription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ directionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY