Concept explainers
Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence
What is the amino acid sequence of the polypeptideproduced from this sequence?
What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?
To analyze:
Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.
From this sequence, the amino acid sequence of the polypeptide produced is to be explained.
Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.
Introduction:
In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.
Transcription Translation
DNA → mRNA → polypeptide
The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.
Amino acid → polypeptide → Protein molecule
Explanation of Solution
The DNA template will undergo the following process to form the polypeptide chain:
3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template
↓ Transcription
5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA
↓ Translation
N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain
Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.
The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.
The term “homodimer” is used when two identical polypeptide chains are bounded together.
Want to see more full solutions like this?
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
- Identify the number of amino acids per 360o turn of an alpha helix. Given this information, how many degrees of separation would you expect between each amino acid in an alpha helix?arrow_forwardIf an Arg residue in a protein was replaced with either Lys or Glu amino acid, whichsubstitution would you expect to result in the greatest structural change and why?arrow_forwardIn the following polypeptide, which amino acid would be participating in hydrogen bonding with alanine, given this sequence forms an alpha helix? Please write out the full amino acid name, not the abbreviation. Met-Ala-Leu-Glu-Lys-Thr-Leu-Valarrow_forward
- Imagine a globular protein with a histidine that is involved in a salt bridge to an aspartic acid, in an internal (hydrophobic) region of the protein. What would happen to the pKa of that histidine R group if the protein was mutated, and the aspartic acid was replaced with an alanine? (i.e., would the pKa increase, decrease, or stay the same?). Assume that the location of the histidine stays the same. Explain your answer clearlyarrow_forwardTo create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forwardWhere would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine to be located in a folded polypeptide? explainarrow_forward
- Why do think nucleotides are also sometimes referred to as “bases” or “nucleotide bases”? What is the difference between a nucleotide and a nucleoside? Explain by giving an example, using structures. What kind of bond links a base to some sugar? Is the sugar an alpha or beta anomer? In what position(s) of the sugar does this occur? In what position(s) of the base does this occur? Instead of the term “Formation of a nucleoside”, what could the name of the reaction be? What functional group is being formed? Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.arrow_forwardA protein with which of the following sequences may be more prone to undergo farnesylation? (a) Trp-Ala-Ala-Cys (b) Ser-Gly-Gly-Glu (c) Ser-Ala-Ala-Trp (d) Cys-Leu-Leu-Serarrow_forwardA peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu, 1 Gly, 1 Ser Reaction of the intact peptide with dansyl chloride followed by acid hydrolysis creates a derivative of Met. A specific cleavage of the intact peptide produces fragments with the following sequences: Fragment A: Glu-Gly-Lys-Phe Fragment B: Met-Ser-Leu-Arg Fragment C: Met-Val-Glu-Phe Which reagent was used for the specific cleavage? Cyanogen bromide Carboxypeptidase A Trypsin Chymotrypsinarrow_forward
- A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu, 1 Gly, 1 Ser Reaction of the intact peptide with dansyl chloride followed by acid hydrolysis creates a derivative of Met. A specific cleavage of the intact peptide produces fragments with the following sequences: Fragment A: Glu-Gly-Lys-Phe Fragment B: Met-Ser-Leu-Arg Fragment C: Met-Val-Glu-Phe What information do this result give about the sequence of the peptide? Explain how you arrived on you answer.arrow_forwardA particular amino acid contains a- CHNH3+ group. Is this amino acid more likely to be found on the inside or the outside of the folded protein? Briefly explain.arrow_forwardAn unspecified protein contains a 15-residue long α-helix with the following sequence: WEANIKQRLSTMGEYKQCHANG a. How many full turns are there in this α-helix? b. What is the length of the helix (in Angstroms) in the direction of the helix axis? c. How many hydrogen bonding interactions would be there in this α-helix? d. If it was a 310 helix instead with a helical pitch of 6 Å, is it long enough to span the 30 Å bilayer? Calculate and explain.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education