![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Concept explainers
Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence
What is the amino acid sequence of the polypeptideproduced from this sequence?
What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?
![Check Mark](/static/check-mark.png)
To analyze:
Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.
From this sequence, the amino acid sequence of the polypeptide produced is to be explained.
Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.
Introduction:
In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.
Transcription Translation
DNA → mRNA → polypeptide
The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.
Amino acid → polypeptide → Protein molecule
Explanation of Solution
The DNA template will undergo the following process to form the polypeptide chain:
3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template
↓ Transcription
5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA
↓ Translation
N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain
Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.
The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.
The term “homodimer” is used when two identical polypeptide chains are bounded together.
Want to see more full solutions like this?
Chapter 9 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
- Consider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that one glutamate residue at some specific position in the helix were mutated to a leucine residue. The mutation could either make the helix more stable, or less stable. i) Describe two situations in which a Glu-to-Leu mutation could make the helix more stable. ii) Describe two situations in which the Glu-to-Leu mutation could make the helix less stable. Explain briefly the basis for the stabilizing and destabilizing effect in all cases.arrow_forwardUsing a copy of a helical wheel (attached to the end) plot the amino acids of the helix on the helical wheel. Is there any evidence of the helix as a whole being amphipathic or having a “sidedness"? Explain yes or no. Are the amino acid side chains in close proximity of one another or staggered to minimize steric hinderance between side chains? Explain the pattern you observe.arrow_forwardA protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown here. Only one of the Cys has a free —SH group, and the other two are involved in an —S—S— bond. The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., withdisulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the —S—S— bond (i.e., AB, BC, or AC)?arrow_forward
- For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’? How many nucleotide ‘non-backbone’ subunits are present? How many phosphodiester linkages are present? What is the overall charge carried by the trinucleotide?arrow_forwardRemembering that the amino acid side chains projecting from each polypeptide backbone in a β sheet point alternately above and below the plane of the sheet, consider the following protein sequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg- Leu-Lys-Ile-Arg-Phe-Glu. Do you find anything remarkable about the arrangement of the amino acids in this sequence when incorporated into a β sheet? Can you make any predictions as to how the β sheet might be arranged in a protein?arrow_forwardThe genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forward
- The diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'arrow_forwardFor each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCC 3' 1. Draw the structure of each polypeptide. 2. Label the amide bonds. 3. Identify the N-terminal and C-terminal amino acids. 4. Write the name of each polypeptide.arrow_forwardWhat is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-arrow_forward
- The bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the free diff usion of Na+ and K+ ions, thereby killing the cell. This peptide consists of a sequence of Dand L-amino acids. The sequence of a segment of fi ve amino acids in gramicidin A is R-Gly-L-Ala-D-Leu-L-Ala-D-Val-R′. Complete the Fischer projection below by adding the correct group to each vertical bond.arrow_forwardTo visualize the spatial arrangement of amino acid residues in an a-helix, it is helpful to imagine you are looking down the long axis of the helix, just as you would look down a soda straw. Viewed in this orientation, the residues form a circle, with each residue offset from its neighbor by 100 degrees. This representation is called a helical wheel. Use the circle below to indicate the position of each residue around the helix of the enzyme lysozyme. NH ...Arg - Cys - Glu- Leu - Ala Ala - Ala Met-Lys COO- The first two amino acids, Arg-1 and Cys-2, are shown as an example. Arg-1 O Glu-3 Which amino acid in the polypeptide is the first to pass the origin (i.e., which amino acid passes Arg- 1 first, completing one full circle)? Select the best answer. O Leu-4 O Ala-5 O Ala-6 O Ala-7 Met-8 O Lys-9 100° O none of the above Cys-2arrow_forwardSYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions between two different proteins. SYNZIP1 is around 47 amino acids in length. If each turn in an a-helix is 3.6 residues in length and each turn is 5.4 Å in length, how long is SYNZIP1? Keep in mind that 1 Å = 10 nm. Present your answer in nm.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)