Based on the DNA sequence encoding five amino acid polypeptide and answer the following: Identify the template and coding strands of DNA and locate the sequence encoding five amino acid of the polypeptides. Give the sequence and polarity of mRNA encoding the polypeptide. Give the polypeptide sequence and identify the N- and C- terminus. Identify the region encoding the shine dalgarno sequence. Explain the function of Shine dalgarno sequence. Introduction: In molecular biology, the central dogma describes the formation of polypeptide chain from the template DNA strand through the intermediate formation of mRNA. Transcription Translation DNA —- ———–> mRNA – ———-> polypeptide The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is the triplet of nitrogen bases coding the specific amino acids. These amino acids are bound together by peptide bond to form polypeptides.

Question

Want to see the full answer?

Answer 1

Question

Chapter 9, Problem 30P

Summary Introduction

To review:

Based on the DNA sequence encoding five amino acid polypeptide and answer the following:

Identify the template and coding strands of DNA and locate the sequence encoding five amino acid of the polypeptides.

Give the sequence and polarity of mRNA encoding the polypeptide.

Give the polypeptide sequence and identify the N- and C- terminus.

Identify the region encoding the shine dalgarno sequence.

Explain the function of Shine dalgarno sequence.

Introduction:

In molecular biology, the central dogma describes the formation of polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA —- ———–> mRNA – ———-> polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is the triplet of nitrogen bases coding the specific amino acids. These amino acids are bound together by peptide bond to form polypeptides.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?

Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G

Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?